hGUHO13186

DGRC Stock Number: 1667296

RRID: RRID:DGRC_1667296

Donor: BDGP

This clones has been validated by BDGP. 3' end sequencing has confirmedq the tag exists in-frame with at least the last several bases of the ORF.



No Image Available


Price: $52.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO13186

When publishing experiments using hGUHO13186, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO13186 (DGRC Stock 1667296 ; https://dgrc.bio.indiana.edu//stock/1667296 ; RRID:DGRC_1667296)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene EXOC1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Sec3 EXOC1 14 Yes Yes
Base Vector pGW-HA.attB
Tag Info 3xHA
Sequenced 5' End CAAGTTTGTACAAAAAAGTTGGCACCATGACAGCAATCAAGCATGCATTACAAAGAGACATTTTTACACCAAATGATGAACGCCTGCTGAGCATTGTGAATGTCTGCAAAGCAGGAAAAAAGAAAAAGAACTGTTTTTTATGTGCCACAGTGACAACTGAACGCCCTGTGCAGGTTAAGGTGGTCAAAGTCAAGAAATCCGATAAGGGAGATTTCTACAAAAGGCAGATTGCATGGGCCCTTCGAGATCTTGCGGTGGTAGATGCCAAAGATGCTATCAAAGAAAATCCTGAATTTGATTTACACTTTGAAAAAATATATAAATGGGTTGCCAGCAGCACTGCTGAAAAGAATGCATTTATTTCATGCATTTGGAAATTGAATCAGCGATATCTCCGGAAGAAAATTGATTTTGTCAATGTTAGCTCACAGCTTTTGGAAGAATCTGTTCCAAGTGGAGAAAATCAGAGTGTGACAGGAGGTGATGAAGAAGTAGTAGATGAATACCAAGAGTTAAATGCAAGAGAAGAACAGGATATCGAAATAATGATGGAAGGCTGTGAATATGCAATCTCGAATGCGGAAGCCTTTGCAGAAAAATTGTCCAGAGAGCTGCAGTGCTAGATGGGGCTAACATCCAGTCAATCATGGCATCTGAAAAACAAGTCAACATCCTGATGAAATTGCTAGATGAGGCTCTAAAGGAGGTAGATCAGATTGAATTGAAACTGAGCAGTTATGAGGAAATGCTCCAAAGTGTAAAAGAACAATGGATCAGATCTCTGAAAGCAACCACCTATTTCATTCTAGTAACACTAATATGTAAAACCTCTATCTGAGATAGAGTTCTTGTGACCACATGGACTTGACAAGGTCATATAAGGCCTTCAGGAAGGAGAATCTTGCCTTCTTCAGAGGCATTGAA
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.51|A|7 Available