hGUHO05090
|
DGRC Stock Number: 1666658 RRID: RRID:DGRC_1666658 Donor: BDGP This clones has been validated by BDGP. 3' end sequencing has confirmedq the tag exists in-frame with at least the last several bases of the ORF. |
No Image Available
Price: $63.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite hGUHO05090
When publishing experiments using hGUHO05090, please include the following details in your manuscript.
- Materials and Methods
hGUHO05090 (DGRC Stock 1666658 ; https://dgrc.bio.indiana.edu//stock/1666658 ; RRID:DGRC_1666658)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Homo sapiens | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Collections |
Human ORF |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Human Gene | DYNC1I2 ( Entrez , HGNC ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthology |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Base Vector | pGW-HA.attB | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tag Info | 3xHA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequenced 3' End | TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACTTCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG |
| Collection | Well | Status | Note |
|---|---|---|---|
| Human ORF | HumanORF hGUHO-RA.44|D|5 | Available |
