DGRC Stock Number: 1666654 RRID: RRID:DGRC_1666654 Donor: BDGP This clones has been validated by BDGP. 3' end sequencing has confirmedq the tag exists in-frame with at least the last several bases of the ORF. |
No Image Available
Price: $60.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite hGUHO05038
When publishing experiments using hGUHO05038, please include the following details in your manuscript.
- Materials and Methods
hGUHO05038 (DGRC Stock 1666654 ; https://dgrc.bio.indiana.edu//stock/1666654 ; RRID:DGRC_1666654)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Homo sapiens | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Collections |
Human ORF |
||||||||||||
Human Gene | CRY1 ( Entrez , HGNC ) | ||||||||||||
Orthology |
|
||||||||||||
Base Vector | pGW-HA.attB | ||||||||||||
Tag Info | 3xHA | ||||||||||||
Sequenced 3' End | TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG |
Collection | Well | Status | Note |
---|---|---|---|
Human ORF | HumanORF hGUHO-RA.44|D|1 | Available |