B17-sg2
|
DGRC Stock Number: 1664586 RRID: RRID:DGRC_1664586 Donor: R. Padinjat |
No Image Available
Price: $60.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite B17-sg2
When publishing experiments using B17-sg2, please include the following details in your manuscript.
- Materials and Methods
B17-sg2 (DGRC Stock 1664586 ; https://dgrc.bio.indiana.edu//stock/1664586 ; RRID:DGRC_1664586)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
- Trivedi et al., 2020
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | Cip4 (FBgn0035533) |
| Collections |
Phosphoinositide signaling gRNA Library |
| Vector | pBFv6.2B |
| sg2 | AACTCCAATGGCTGGGACGAGGG |
| Collection | Well | Status | Note |
|---|---|---|---|
| Phosphoinositide signaling gRNA Library | NCBSgRNA Plate 2|A|8 | Available |
