hGUHO05065

DGRC Stock Number: 1662445

RRID: RRID:DGRC_1662445

Donor: BDGP

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $52.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO05065

When publishing experiments using hGUHO05065, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO05065 (DGRC Stock 1662445 ; https://dgrc.bio.indiana.edu//stock/1662445 ; RRID:DGRC_1662445)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SLC13A1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Indy SLC13A1 11 No Yes
CG7309 SLC13A1 6 Yes No
Indy-2 SLC13A1 10 Yes No
CG33934 SLC13A1 10 Yes No
Base Vector pGW-HA.attB
AA Size 677
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAATTCTTCAGTTACATTCTGGTTTATCGCCGATTTCTCTTCGTGGTTTTCACTGTGTTGGTTTTACTACCTCTGCCCATCGTCCTCCACACCAAGGAAGCAGAATGTGCCTACACACTCTTTGTGGTCGCCACATTTTGGCTCACAGAAGCATTGCCTCTGTCGGTAACAGCTTTGCTACCTAGTTTAATGTTACCCATGTTTGGGATCATGCCTTCTAAGAAGGTGGCATCTGCTTATTTCAAGGATTTTCACTTACTGCTAATTGGAGTTATCTGTTTAGCAACATCCATAGAAAAATGGAATTTGCACAAGAGAATTGCTCTGAAAATGGTGATGATGGTTGGTGTAAATCCTGCATGGCTGACGCTGGGGTTCATGAGCAGCACTGCCTTTTTGTCTATGTGGCTCAGCAACACCTCGACGGCTGCCATGGTGATGCCCATTGCGGAGGCTGTAGTGCAGCAGATCATCAATGCAGAAGCAGAGGTCGAGGCCACTCAGATGACTTACTTCAACGGATCAACCAACCACGGACTAGAAATTGATGAAAGTGTTAATGGACATGAAATAAATGAGAGGAAAGAGAAAACAAAACCAGTTCCAGGATACAATAATGATACAGGGAAAATTTCAAGCAAGGTGGAGTTGGAAAAGAACTCAGGCATGAGAACCAAATATCGAACAAAGAAGGGCCACGTGACACGTAAACTTACGTGTTTGTGCATTGCCTACTCTTCTACCATTGGTGGACTGACAACAATCACTGGTACCTCCACCAACTTGATCTTTGCAGAGTATTTCAATACACGCTATCCTGACTGTCGTTGCCTCAACTTTGGATCATGGTTTACGTTTTCCTTCCCAGCTGCCCTTATCATTCTACTCTTATCCTGGATCTGGCTTCAGTGGCTTTTCCTAGGATTCAATTTTAAGGAGATGTTCAAATGTGGCAAAACCAAAACAGTCCAACAAAAAGCTTGTGCTGAGGTGATTAAGCAAGAATACCAAAAGCTTGGGCCAATAAGGTATCAAGAAATTGTGACCTTGGTCCTCTTCATTATAATGGCTCTGCTATGGTTTAGTCGAGACCCCGGATTTGTTCCTGGTTGGTCTGCACTTTTTTCAGAGTACCCTGGTTTTGCTACAGATTCAACTGTTGCTTTACTTATAGGGCTGCTATTCTTTCTTATCCCAGCTAAGACACTGACTAAAACTACACCTACAGGAGAAATTGTTGCTTTTGATTACTCTCCACTGATTACTTGGAAAGAATTCCAGTCATTCATGCCCTGGGATATAGCCATTCTTGTTGGTGGAGGGTTTGCCCTGGCAGATGGTTGTGAGGAGTCTGGATTATCTAAGTGGATAGGAAATAAATTATCTCCTCTGGGTTCATTACCAGCATGGCTAATAATTCTGATATCTTCTTTGATGGTGACATCTTTAACTGAGGTAGCCAGCAATCCAGCTACCATTACACTCTTTCTCCCAATATTATCTCCATTGGCCGAAGCCATTCATGTGAACCCTCTTTATATTCTGATACCTTCTACTCTGTGTACTTCATTTGCATTCCTCCTACCAGTAGCAAATCCACCCAATGCTATTGTCTTTTCATATGGTCATCTGAAAGTCATTGACATGGTTAAAGCTGGACTTGGTGTCAACATTGTTGGTGTTGCTGTGGTTATGCTTGGCATATGTACTTGGATTGTACCCATGTTTGACCTCTACACTTACCCTTCGTGGGCTCCTGCTATGAGTAATGAGACCATGCCATCAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MKFFSYILVYRRFLFVVFTVLVLLPLPIVLHTKEAECAYTLFVVATFWLTEALPLSVTALLPSLMLPMFGIMPSKKVASAYFKDFHLLLIGVICLATSIEKWNLHKRIALKMVMMVGVNPAWLTLGFMSSTAFLSMWLSNTSTAAMVMPIAEAVVQQIINAEAEVEATQMTYFNGSTNHGLEIDESVNGHEINERKEKTKPVPGYNNDTGKISSKVELEKNSGMRTKYRTKKGHVTRKLTCLCIAYSSTIGGLTTITGTSTNLIFAEYFNTRYPDCRCLNFGSWFTFSFPAALIILLLSWIWLQWLFLGFNFKEMFKCGKTKTVQQKACAEVIKQEYQKLGPIRYQEIVTLVLFIIMALLWFSRDPGFVPGWSALFSEYPGFATDSTVALLIGLLFFLIPAKTLTKTTPTGEIVAFDYSPLITWKEFQSFMPWDIAILVGGGFALADGCEESGLSKWIGNKLSPLGSLPAWLIILISSLMVTSLTEVASNPATITLFLPILSPLAEAIHVNPLYILIPSTLCTSFAFLLPVANPPNAIVFSYGHLKVIDMVKAGLGVNIVGVAVVMLGICTWIVPMFDLYTYPSWAPAMSNETMPSGLMGPAFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End AAGGGCCGTCAAGGCCCACCATGAAATTCTTCAGTTACATTCTGGTTTATCGCCGATTTCTCTTCGTGGTTTTCACTGTGTTGGTTTTACTACCTCTGCCCATCGTCCTCCACACCAAGGAAGCAGAATGTGCCTACACACTCTTTGTGGTCGCCACATTTTGGCTCACAGAAGCATTGCCTCTGTCGGTAACAGCTTTGCTACCTAGTTTAATGTTACCCATGTTTGGGATCATGCCTTCTAAGAAGGTGGCATCTGCTTATTTCAAGGATTTTCACTTACTGCTAATTGGAGTTATCTGTTTAGCAACATCCATAGAAAAATGGAATTTGCACAAGAGAATTGCTCTGAAAATGGTGATGATGGTTGGTGTAAATCCTGCATGGCTGACGCTGGGGTTCATGAGCAGCACTGCCTTTTTGTCTATGTGGCTCAGCAACACCTCGACGGCTGCCATGGTGATGCCCATTGCGGAGGCTGTAGTGCAGCAGATCATCAATGCAGAAGCAGAGGTCGAGGCCACTCAGATGACTTACTTCAACGGATCAACCAACCACGGACTAGAAATTGATGAAAGTGTTAATGGACATGAAATAAATGAGAGGAAAGAGAAAACAAAACCAGTTCCAGGATACAATAATGATACAGGGAAAATTTCAAGCAAGGTGGAGTTGGAAAAGAACTCAGCATGAGAACCAAATATCGAACAAAGAAGGCCACGTGACACGTAAACTTACGTGTTTGTGCATTGCCTACTCTTCTACCATTGGTGGACTGACACATCACTGGTACCTCCACCAACTTGATCTTTGCAGAGTATTTCATACACGCTATCCTGACTGTCGTTGCCTCAACTTTGGATCATGTTTACGTTTTCTTCCCAGCTGCCCTTATCATTCTACTCTTATCTGATCTGCTCATGGCTTTTCCTAGATCATTAGGAATGTTCAATGTGGCAAACAAACAGTCACAAAGGCTTGTGCTGGAGGTGATAAGCAGAATACAAGCTTGGTCAATAACGATCAGAA
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.24|B|1 Available