hGUHO05065

DGRC Stock Number: 1662445

RRID: RRID:DGRC_1662445

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO05065

When publishing experiments using hGUHO05065, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO05065 (DGRC Stock 1662445 ; https://dgrc.bio.indiana.edu//stock/1662445 ; RRID:DGRC_1662445)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SLC13A1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Indy SLC13A1 11 No Yes
CG7309 SLC13A1 6 Yes No
Indy-2 SLC13A1 10 Yes No
CG33934 SLC13A1 10 Yes No
Base Vector pGW-HA.attB
AA Size 677
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAATTCTTCAGTTACATTCTGGTTTATCGCCGATTTCTCTTCGTGGTTTTCACTGTGTTGGTTTTACTACCTCTGCCCATCGTCCTCCACACCAAGGAAGCAGAATGTGCCTACACACTCTTTGTGGTCGCCACATTTTGGCTCACAGAAGCATTGCCTCTGTCGGTAACAGCTTTGCTACCTAGTTTAATGTTACCCATGTTTGGGATCATGCCTTCTAAGAAGGTGGCATCTGCTTATTTCAAGGATTTTCACTTACTGCTAATTGGAGTTATCTGTTTAGCAACATCCATAGAAAAATGGAATTTGCACAAGAGAATTGCTCTGAAAATGGTGATGATGGTTGGTGTAAATCCTGCATGGCTGACGCTGGGGTTCATGAGCAGCACTGCCTTTTTGTCTATGTGGCTCAGCAACACCTCGACGGCTGCCATGGTGATGCCCATTGCGGAGGCTGTAGTGCAGCAGATCATCAATGCAGAAGCAGAGGTCGAGGCCACTCAGATGACTTACTTCAACGGATCAACCAACCACGGACTAGAAATTGATGAAAGTGTTAATGGACATGAAATAAATGAGAGGAAAGAGAAAACAAAACCAGTTCCAGGATACAATAATGATACAGGGAAAATTTCAAGCAAGGTGGAGTTGGAAAAGAACTCAGGCATGAGAACCAAATATCGAACAAAGAAGGGCCACGTGACACGTAAACTTACGTGTTTGTGCATTGCCTACTCTTCTACCATTGGTGGACTGACAACAATCACTGGTACCTCCACCAACTTGATCTTTGCAGAGTATTTCAATACACGCTATCCTGACTGTCGTTGCCTCAACTTTGGATCATGGTTTACGTTTTCCTTCCCAGCTGCCCTTATCATTCTACTCTTATCCTGGATCTGGCTTCAGTGGCTTTTCCTAGGATTCAATTTTAAGGAGATGTTCAAATGTGGCAAAACCAAAACAGTCCAACAAAAAGCTTGTGCTGAGGTGATTAAGCAAGAATACCAAAAGCTTGGGCCAATAAGGTATCAAGAAATTGTGACCTTGGTCCTCTTCATTATAATGGCTCTGCTATGGTTTAGTCGAGACCCCGGATTTGTTCCTGGTTGGTCTGCACTTTTTTCAGAGTACCCTGGTTTTGCTACAGATTCAACTGTTGCTTTACTTATAGGGCTGCTATTCTTTCTTATCCCAGCTAAGACACTGACTAAAACTACACCTACAGGAGAAATTGTTGCTTTTGATTACTCTCCACTGATTACTTGGAAAGAATTCCAGTCATTCATGCCCTGGGATATAGCCATTCTTGTTGGTGGAGGGTTTGCCCTGGCAGATGGTTGTGAGGAGTCTGGATTATCTAAGTGGATAGGAAATAAATTATCTCCTCTGGGTTCATTACCAGCATGGCTAATAATTCTGATATCTTCTTTGATGGTGACATCTTTAACTGAGGTAGCCAGCAATCCAGCTACCATTACACTCTTTCTCCCAATATTATCTCCATTGGCCGAAGCCATTCATGTGAACCCTCTTTATATTCTGATACCTTCTACTCTGTGTACTTCATTTGCATTCCTCCTACCAGTAGCAAATCCACCCAATGCTATTGTCTTTTCATATGGTCATCTGAAAGTCATTGACATGGTTAAAGCTGGACTTGGTGTCAACATTGTTGGTGTTGCTGTGGTTATGCTTGGCATATGTACTTGGATTGTACCCATGTTTGACCTCTACACTTACCCTTCGTGGGCTCCTGCTATGAGTAATGAGACCATGCCATCAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MKFFSYILVYRRFLFVVFTVLVLLPLPIVLHTKEAECAYTLFVVATFWLTEALPLSVTALLPSLMLPMFGIMPSKKVASAYFKDFHLLLIGVICLATSIEKWNLHKRIALKMVMMVGVNPAWLTLGFMSSTAFLSMWLSNTSTAAMVMPIAEAVVQQIINAEAEVEATQMTYFNGSTNHGLEIDESVNGHEINERKEKTKPVPGYNNDTGKISSKVELEKNSGMRTKYRTKKGHVTRKLTCLCIAYSSTIGGLTTITGTSTNLIFAEYFNTRYPDCRCLNFGSWFTFSFPAALIILLLSWIWLQWLFLGFNFKEMFKCGKTKTVQQKACAEVIKQEYQKLGPIRYQEIVTLVLFIIMALLWFSRDPGFVPGWSALFSEYPGFATDSTVALLIGLLFFLIPAKTLTKTTPTGEIVAFDYSPLITWKEFQSFMPWDIAILVGGGFALADGCEESGLSKWIGNKLSPLGSLPAWLIILISSLMVTSLTEVASNPATITLFLPILSPLAEAIHVNPLYILIPSTLCTSFAFLLPVANPPNAIVFSYGHLKVIDMVKAGLGVNIVGVAVVMLGICTWIVPMFDLYTYPSWAPAMSNETMPSGLMGPAFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End AAGGGCCGTCAAGGCCCACCATGAAATTCTTCAGTTACATTCTGGTTTATCGCCGATTTCTCTTCGTGGTTTTCACTGTGTTGGTTTTACTACCTCTGCCCATCGTCCTCCACACCAAGGAAGCAGAATGTGCCTACACACTCTTTGTGGTCGCCACATTTTGGCTCACAGAAGCATTGCCTCTGTCGGTAACAGCTTTGCTACCTAGTTTAATGTTACCCATGTTTGGGATCATGCCTTCTAAGAAGGTGGCATCTGCTTATTTCAAGGATTTTCACTTACTGCTAATTGGAGTTATCTGTTTAGCAACATCCATAGAAAAATGGAATTTGCACAAGAGAATTGCTCTGAAAATGGTGATGATGGTTGGTGTAAATCCTGCATGGCTGACGCTGGGGTTCATGAGCAGCACTGCCTTTTTGTCTATGTGGCTCAGCAACACCTCGACGGCTGCCATGGTGATGCCCATTGCGGAGGCTGTAGTGCAGCAGATCATCAATGCAGAAGCAGAGGTCGAGGCCACTCAGATGACTTACTTCAACGGATCAACCAACCACGGACTAGAAATTGATGAAAGTGTTAATGGACATGAAATAAATGAGAGGAAAGAGAAAACAAAACCAGTTCCAGGATACAATAATGATACAGGGAAAATTTCAAGCAAGGTGGAGTTGGAAAAGAACTCAGCATGAGAACCAAATATCGAACAAAGAAGGCCACGTGACACGTAAACTTACGTGTTTGTGCATTGCCTACTCTTCTACCATTGGTGGACTGACACATCACTGGTACCTCCACCAACTTGATCTTTGCAGAGTATTTCATACACGCTATCCTGACTGTCGTTGCCTCAACTTTGGATCATGTTTACGTTTTCTTCCCAGCTGCCCTTATCATTCTACTCTTATCTGATCTGCTCATGGCTTTTCCTAGATCATTAGGAATGTTCAATGTGGCAAACAAACAGTCACAAAGGCTTGTGCTGGAGGTGATAAGCAGAATACAAGCTTGGTCAATAACGATCAGAA
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.24|B|1 Available