hGUHO03638

DGRC Stock Number: 1662146

RRID: RRID:DGRC_1662146

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03638

When publishing experiments using hGUHO03638, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03638 (DGRC Stock 1662146 ; https://dgrc.bio.indiana.edu//stock/1662146 ; RRID:DGRC_1662146)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SERPINB4   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Spn28B SERPINB4 6 Yes No
Spn28Da SERPINB4 6 Yes No
Spn28F SERPINB4 7 Yes No
Spn38F SERPINB4 8 Yes Yes
Base Vector pGW-HA.attB
AA Size 468
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAATTCACTCAGTGAAGCCAACACCAAGTTCATGTTCGATCTGTTCCAACAGTTCAGAAAATCAAAAGAGAACAACATCTTCTATTCCCCTATCAGCATCACATCAGCATTAGGGATGGTCCTCTTAGGAGCCAAAGACAACACTGCACAACAAATTAGCAAGGTTCTTCACTTTGATCAAGTCACAGAGAACACCACAGAAAAAGCTGCAACATATCATGTTGATAGGTCAGGAAATGTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAATCCACTGATGCATATGAGCTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAATTTTTACAGGAATATTTAGATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTACTGATTTTGCAAATGCTCCAGAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATGAAAAAATTAAAAACCTATTTCCTGATGGGACTATTGGCAATGATACGACACTGGTTCTTGTGAACGCAATCTATTTCAAAGGGCAGTGGGAGAATAAATTTAAAAAAGAAAACACTAAAGAGGAAAAATTTTGGCCAAACAAGAATACATACAAATCTGTACAGATGATGAGGCAATACAATTCCTTTAATTTTGCCTTGCTGGAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGATCTAAGCATGATTGTGCTGCTGCCAAATGAAATCGATGGTCTGCAGAAGCTTGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGAGAGACATGTGTCGATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAGGACACGTTGAGAACCATGGGAATGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGCATGACCTGGAGCCACGGTCTCTCAGTATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTCACTGAGGAGGGAGTGGAAGCTGCAGCTGCCACCGCTGTAGTAGTAGTCGAATTATCATCTCCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAATAAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCCCATACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MNSLSEANTKFMFDLFQQFRKSKENNIFYSPISITSALGMVLLGAKDNTAQQISKVLHFDQVTENTTEKAATYHVDRSGNVHHQFQKLLTEFNKSTDAYELKIANKLFGEKTYQFLQEYLDAIKKFYQTSVESTDFANAPEESRKKINSWVESQTNEKIKNLFPDGTIGNDTTLVLVNAIYFKGQWENKFKKENTKEEKFWPNKNTYKSVQMMRQYNSFNFALLEDVQAKVLEIPYKGKDLSMIVLLPNEIDGLQKLEEKLTAEKLMEWTSLQNMRETCVDLHLPRFKMEESYDLKDTLRTMGMVNIFNGDADLSGMTWSHGLSVSKVLHKAFVEVTEEGVEAAAATAVVVVELSSPSTNEEFCCNHPFLFFIRQNKTNSILFYGRFSSPYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.21|A|2 Available