hGUHO03182

DGRC Stock Number: 1662138

RRID: RRID:DGRC_1662138

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03182

When publishing experiments using hGUHO03182, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03182 (DGRC Stock 1662138 ; https://dgrc.bio.indiana.edu//stock/1662138 ; RRID:DGRC_1662138)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PCBP1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
mub PCBP1 12 No Yes
Base Vector pGW-HA.attB
AA Size 434
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGATGCCGGTGTGACTGAAAGTGGACTAAATGTGACTCTCACCATTCGGCTTCTTATGCACGGAAAGGAAGTAGGAAGCATCATTGGGAAGAAAGGGGAGTCGGTTAAGAGGATCCGCGAGGAGAGTGGCGCGCGGATCAACATCTCGGAGGGGAATTGTCCGGAGAGAATCATCACTCTGACCGGCCCCACCAATGCCATCTTTAAGGCTTTCGCTATGATCATCGACAAGCTGGAGGAAGATATCAACAGCTCCATGACCAACAGTACCGCGGCCAGCAGGCCCCCGGTCACCCTGAGGCTGGTGGTGCCGGCCACCCAGTGCGGCTCCCTGATTGGGAAAGGCGGGTGTAAGATCAAAGAGATCCGCGAGAGTACGGGGGCGCAGGTCCAGGTGGCGGGGGATATGCTGCCCAACTCCACCGAGCGGGCCATCACCATCGCTGGCGTGCCGCAGTCTGTCACCGAGTGTGTCAAGCAGATTTGCCTGGTCATGCTGGAGACGCTCTCCCAGTCTCCGCAAGGGAGAGTCATGACCATTCCGTACCAGCCCATGCCGGCCAGCTCCCCAGTCATCTGCGCGGGCGGCCAAGATCGGTGCAGCGACGCTGCGGGCTACCCCCATGCCACCCATGACCTGGAGGGACCACCTCTAGATGCCTACTCGATTCAAGGACAACACACCATTTCTCCGCTCGATCTGGCCAAGCTGAACCAGGTGGCAAGACAACAGTCTCACTTTGCCATGATGCACGGCGGGACCGGATTCGCCGGAATTGACTCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCAAGTTTGGATGCATCTACTCAAACCACCCATGAACTCACCATTCCAAATAACTTAATTGGCTGCATAATCGGGCGCCAAGGCGCCAACATTAATGAGATCCGCCAGATGTCCGGGGCCCAGATCAAAATTGCCAACCCAGTGGAAGGCTCCTCTGGTAGGCAGGTTACTATCACTGGCTCTGCTGCCAGTATTAGTCTGGCCCAGTATCTAATCAATGCCAGGCTTTCCTCTGAGAAGGGCATGGGGTGCAGCTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MDAGVTESGLNVTLTIRLLMHGKEVGSIIGKKGESVKRIREESGARINISEGNCPERIITLTGPTNAIFKAFAMIIDKLEEDINSSMTNSTAASRPPVTLRLVVPATQCGSLIGKGGCKIKEIRESTGAQVQVAGDMLPNSTERAITIAGVPQSVTECVKQICLVMLETLSQSPQGRVMTIPYQPMPASSPVICAGGQDRCSDAAGYPHATHDLEGPPLDAYSIQGQHTISPLDLAKLNQVARQQSHFAMMHGGTGFAGIDSSSPEVKGYWASLDASTQTTHELTIPNNLIGCIIGRQGANINEIRQMSGAQIKIANPVEGSSGRQVTITGSAASISLAQYLINARLSSEKGMGCSYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|H|6 Available