hGUHO03203

DGRC Stock Number: 1662097

RRID: RRID:DGRC_1662097

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03203

When publishing experiments using hGUHO03203, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03203 (DGRC Stock 1662097 ; https://dgrc.bio.indiana.edu//stock/1662097 ; RRID:DGRC_1662097)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PCBP4   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
mub PCBP4 10 No Yes
Base Vector pGW-HA.attB
AA Size 438
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAGCGGCTCGGACGGGGGACTGGAGGAGGAGCCAGAGCTCAGCATCACCCTCACGCTGCGGATGCTGATGCACGGGAAGGAAGTGGGCAGCATCATCGGGAAGAAGGGCGAGACTGTAAAGCGAATCCGGGAGCAGAGCAGTGCCCGGATCACCATCTCCGAGGGCTCCTGCCCTGAACGCATCACCACCATCACCGGGTCTACAGCAGCTGTCTTCCATGCAGTCTCCATGATTGCTTTCAAACTGGATGAGGACCTTTGTGCTGCTCCTGCAAATGGTGGAAATGTCTCCAGGCCTCCAGTGACCCTGCGCCTTGTCATCCCTGCCAGTCAGTGTGGCTCACTGATTGGGAAGGCTGGCACCAAGATCAAGGAGATCCGAGAGTCCCCACCCAAAGGAGCCACTATCCCCTACCATCCGAGCCTCTCCCTAGGTACTGTTCTTCTCTCTGCCAACCAGGGCTTCTCTGTCCAGGGTCAGTATGGGGCTGTGACCCCAGCTGAGGTCACCAAGCTCCAGCAGCTCTCAAGCCATGCGGTCCCCTTTGCCACACCCAGCGTGGTGCCAGGACTGGATCCCGGCACACAGACCAGCTCACAGGAGTTCTTGGTTCCCAACGATTTGATTGGCTGTGTGATCGGGCGCCAGGGCAGCAAGATCAGCGAGATCCGGCAGATGTCAGGGGCACATATCAAGATCGGGAACCAAGCAGAGGGCGCTGGGGAGCGGCATGTCACCATCACTGGCTCTCCGGTCTCCATCGCCCTGGCCCAGTACCTCATCACTGCCTGTCTAGAGACGGCCAAGTCTACCTCTGGGGGGACGCCCAGCTCGGCCCCCGCAGACCTGCCTGCCCCCTTCTCGCCACCCCTGACGGCCCTGCCCACAGCTCCCCCTGGCCTGCTGGGCACACCCTATGCCATCTCCCTCTCCAACTTCATCGGCCTCAAGCCCATGCCCTTCTTGGCTTTACCACCTGCTTCCCCAGGGCCGCCGCCGGGCTTGGCGGCCTACACTGCCAAGATGGCAGCAGCTAATGGGAGCAAGAAGGCTGAGCGGCAGAAATTCTCCCCCTACTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSGSDGGLEEEPELSITLTLRMLMHGKEVGSIIGKKGETVKRIREQSSARITISEGSCPERITTITGSTAAVFHAVSMIAFKLDEDLCAAPANGGNVSRPPVTLRLVIPASQCGSLIGKAGTKIKEIRESPPKGATIPYHPSLSLGTVLLSANQGFSVQGQYGAVTPAEVTKLQQLSSHAVPFATPSVVPGLDPGTQTSSQEFLVPNDLIGCVIGRQGSKISEIRQMSGAHIKIGNQAEGAGERHVTITGSPVSIALAQYLITACLETAKSTSGGTPSSAPADLPAPFSPPLTALPTAPPGLLGTPYAISLSNFIGLKPMPFLALPPASPGPPPGLAAYTAKMAAANGSKKAERQKFSPYCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|E|1 Available