hGUHO03652

DGRC Stock Number: 1662026

RRID: RRID:DGRC_1662026

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03652

When publishing experiments using hGUHO03652, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03652 (DGRC Stock 1662026 ; https://dgrc.bio.indiana.edu//stock/1662026 ; RRID:DGRC_1662026)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SEPHS1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
SelD SEPHS1 15 Yes Yes
Sps2 SEPHS1 6 Yes No
Base Vector pGW-HA.attB
AA Size 470
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGTCTACGCGGGAGTCCTTTAACCCGGAAAGTTACGAATTGGACAAAAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACAGGCTGCAAAGTGCCCCAAGATGTCCTGCAAAAATTGCTGGAATCTTTACAGGAGAACCACTTCCAAGAAGATGAGCAGTTTCTGGGAGCCGTTATGCCAAGGCTTGGCATTGGAATGGATACTTGTGTCATTCCTTTGAGGCACGGTGGGCTTTCCTTGGTTCAAACCACAGATTACATTTACCCGATCGTAGACGACCCTTACATGATGGGCAGGATAGCGTGTGCCAATGTCCTCAGTGACCTCTATGCAATGGGGGTCACGGAATGTGACAATATGCTGATGCTCCTTGGAGTCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCTCTGATTATCCAAGGTTTTAAAGACGCAGCTGAGGAAGCAGGAACATCTGTAACAGGCGGCCAAACAGTACTAAACCCCTGGATTGTCCTGGGAGGAGTGGCTACCACTGTCTGCCAACCCAATGAATTTATCATGCCAGACAATGCAGTGCCAGGGGACGTGCTGGTGCTGACAAAACCCCTGGGGACACAGGTGGCAGTGGCTGTGCACCAGTGGCTGGATATCCCTGAGAAATGGAATAAGATTAAACTAGTGGTCACCCAAGAAGATGTAGAGCTGGCCTACCAGGAGGCGATGATGAACATGGCGAGGCTCAACAGGACAGCTGCAGGACTCATGCACACGTTCAATGCCCACGCCGCCACTGACATCACGGGCTTCGGGATTTTGGGCCATGCGCAGAACCTGGCCAAGCAGCAGAGGAACGAGGTGTCGTTTGTAATTCACAACCTCCCGGTGCTGGCCAAGATGGCTGCGGTGAGCAAGGCCTGCGGAAACATGTTCGGCCTCATGCACGGGACCTGCCCGGAGACTTCAGGCGGCCTTCTGATCTGTTTACCACGTGAGCAAGCAGCTCGGTTCTGTGCAGAGATAAAGTCCCCCAAATATGGTGAAGGCCACCAAGCATGGATTATTGGGATTGTAGAGAAGGGCAACCGCACAGCCAGAATCATAGACAAACCCCGGATCATCGAGGTCGCACCACAAGTGGCCACTCAAAATGTGAATCCCACACCCGGGGCCACCTCTTACCCAACTTTCATGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSTRESFNPESYELDKSFRLTRFTELKGTGCKVPQDVLQKLLESLQENHFQEDEQFLGAVMPRLGIGMDTCVIPLRHGGLSLVQTTDYIYPIVDDPYMMGRIACANVLSDLYAMGVTECDNMLMLLGVSNKMTDRERDKVMPLIIQGFKDAAEEAGTSVTGGQTVLNPWIVLGGVATTVCQPNEFIMPDNAVPGDVLVLTKPLGTQVAVAVHQWLDIPEKWNKIKLVVTQEDVELAYQEAMMNMARLNRTAAGLMHTFNAHAATDITGFGILGHAQNLAKQQRNEVSFVIHNLPVLAKMAAVSKACGNMFGLMHGTCPETSGGLLICLPREQAARFCAEIKSPKYGEGHQAWIIGIVEKGNRTARIIDKPRIIEVAPQVATQNVNPTPGATSYPTFMYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.19|G|2 Available