hGUHO03758

DGRC Stock Number: 1662017

RRID: RRID:DGRC_1662017

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03758

When publishing experiments using hGUHO03758, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03758 (DGRC Stock 1662017 ; https://dgrc.bio.indiana.edu//stock/1662017 ; RRID:DGRC_1662017)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SH3BP5L   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
pcs SH3BP5L 8 Yes No
CG14408 SH3BP5L 9 Yes Yes
Base Vector pGW-HA.attB
AA Size 471
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGCTGAGCTCAGACAGGTTCCAGGAGGGCGGGAGACCCCACAGGGGGAGCTGCGGCCTGAAGTTGTAGAGGATGAAGTCCCTAGGAGCCCAGTCGCAGAAGAGCCTGGAGGAGGTGGAAGCAGCAGCAGTGAGGCCAAATTGTCCCCAAGAGAGGAGGAAGAACTGGATCCTAGAATACAGGAGGAGTTGGAGCACCTGAACCAGGCCAGCGAGGAGATCAACCAGGTGGAACTACAGCTGGATGAGGCCAGGACCACCTATCGGAGGATCCTACAGGAGTCGGCGAGGAAACTGAATACACAGGGTTCCCACTTGGGGAGCTGCATCGAGAAAGCCCGGCCCTACTATGAGGCTCGGCGGCTGGCTAAGGAGGCTCAGCAGGAGACACAGAAGGCAGCGCTGCGGTACGAGCGGGCCGTAAGCATGCACAACGCTGCTCGAGAAATGGTGTTTGTGGCTGAGCAGGGCGTCATGGCTGACAAGAACCGACTGGACCCCACGTGGCAGGAGATGCTGAACCATGCTACCTGCAAGGTGAATGAGGCGGAGGAAGAGCGGCTTCGAGGTGAGCGGGAGCACCAGCGAGTGACTCGGCTGTGCCAACAGGCTGAGGCTCGGGTCCAAGCCCTGCAGAAGACCCTCCGGAGGGCCATCGGCAAGAGCCGCCCCTACTTTGAGCTCAAGGCCCAGTTCAGCCAGATCCTGGAGGAGCACAAGGCCAAGGTGACAGAACTGGAGCAGCAGGTAGCTCAGGCCAAGACGCGCTACTCCGTGGCCCTTCGTAACCTGGAGCAGATCAGCGAGCAGATTCACGCACGGCGCCGCGGGGGTCTGCCTCCCCACCCCCTGGGCCCTCGGCGCTCCTCCCCCGTGGGGGCCGAGGCAGGACCCGAGGACATGGAGGACGGAGACAGCGGGATTGAGGGGGCCGAGGGTGCGGGGCTGGAGGAGGGCAGCAGCCTGGGGCCCGGCCCCGCCCCCGACACCGATACCCTGAGTCTGCTGAGCCTGCGCACGGTGGCTTCAGACCTGCAGAAGTGCGACTCCGTGGAGCACTTGCGAGGCCTCTCGGACCACGTCAGTCTGGACGGCCAAGAGCTGGGAACGCGGAGTGGAGGGCGCCGGGGCAGCGACGGCGGAGCCCGTGGGGGTCGGCACCAGCGCAGCGTCAGCCTGTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MAELRQVPGGRETPQGELRPEVVEDEVPRSPVAEEPGGGGSSSSEAKLSPREEEELDPRIQEELEHLNQASEEINQVELQLDEARTTYRRILQESARKLNTQGSHLGSCIEKARPYYEARRLAKEAQQETQKAALRYERAVSMHNAAREMVFVAEQGVMADKNRLDPTWQEMLNHATCKVNEAEEERLRGEREHQRVTRLCQQAEARVQALQKTLRRAIGKSRPYFELKAQFSQILEEHKAKVTELEQQVAQAKTRYSVALRNLEQISEQIHARRRGGLPPHPLGPRRSSPVGAEAGPEDMEDGDSGIEGAEGAGLEEGSSLGPGPAPDTDTLSLLSLRTVASDLQKCDSVEHLRGLSDHVSLDGQELGTRSGGRRGSDGGARGGRHQRSVSLYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.19|F|5 Available