hGUHO03813

DGRC Stock Number: 1662005

RRID: RRID:DGRC_1662005

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03813

When publishing experiments using hGUHO03813, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03813 (DGRC Stock 1662005 ; https://dgrc.bio.indiana.edu//stock/1662005 ; RRID:DGRC_1662005)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene EIF4A1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
eIF-4a EIF4A1 12 Yes Yes
Base Vector pGW-HA.attB
AA Size 484
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAAGGCGTCATCGAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCTCGGAGTCCCTTCTCCGTGGCATCTACGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTACCTTGTATCAAGGGTTATGATGTGATTGCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATTTGCCATATCAATTCTGCAGCAGATTGAATTAGATCTAAAAGCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCTCAGCAGATACAGAAGGTGGTCATGGCACTAGGAGACTACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAACGTGCGTGCTGAGGTGCAGAAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGCCGTGTGTTTGATATGCTTAACCGGAGATACCTGTCCCCCAAATACATCAAGATGTTTGTACTGGATGAAGCTGACGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAGCAACACCCAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGATGTGCTTGAGGTGACCAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTGGAACGAGAGGAGTGGAAGCTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCATCAACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTATCCGCCATGCATGGAGATATGGACCAAAAGGAACGAGACGTGATTATGAGGGAGTTTCGTTCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGCCAGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTATATCCACAGAATCGGTCGAGGTGGACGGTTTGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAGGACTCTTCGAGACATTGAGACCTTCTACAACACCTCCATTGAGGAAATGCCCCTCAATGTTGCTGACCTCATCTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSASQDSRSRDNGPDGMEPEGVIESNWNEIVDSFDDMNLSESLLRGIYAYGFEKPSAIQQRAILPCIKGYDVIAQAQSGTGKTATFAISILQQIELDLKATQALVLAPTRELAQQIQKVVMALGDYMGASCHACIGGTNVRAEVQKLQMEAPHIIVGTPGRVFDMLNRRYLSPKYIKMFVLDEADEMLSRGFKDQIYDIFQKLNSNTQVVLLSATMPSDVLEVTKKFMRDPIRILVKKEELTLEGIRQFYINVEREEWKLDTLCDLYETLTITQAVIFINTRRKVDWLTEKMHARDFTVSAMHGDMDQKERDVIMREFRSGSSRVLITTDLLARGIDVQQVSLVINYDLPTNRENYIHRIGRGGRFGRKGVAINMVTEEDKRTLRDIETFYNTSIEEMPLNVADLICPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.19|E|5 Available