hGUHO03724

DGRC Stock Number: 1661976

RRID: RRID:DGRC_1661976

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03724

When publishing experiments using hGUHO03724, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03724 (DGRC Stock 1661976 ; https://dgrc.bio.indiana.edu//stock/1661976 ; RRID:DGRC_1661976)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene ACP3   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG6656 ACP3 6 Yes No
Acph-1 ACP3 11 No Yes
CG9451 ACP3 6 Yes No
CG9449 ACP3 9 Yes No
Base Vector pGW-HA.attB
AA Size 464
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAGAGCTGCACCCCTCCTCCTGGCCAGGGCAGCAAGCCTTAGCCTTGGCTTCTTGTTTCTGCTTTTTTTCTGGCTAGACCGAAGTGTACTAGCCAAGGAGTTGAAGTTTGTGACTTTGGTGTTTCGGCATGGAGACCGAAGTCCCATTGACACCTTTCCCACTGACCCCATAAAGGAATCCTCATGGCCACAAGGATTTGGCCAACTCACCCAGCTGGGCATGGAGCAGCATTATGAACTTGGAGAGTATATAAGAAAGAGATATAGAAAATTCTTGAATGAGTCCTATAAACATGAACAGGTTTATATTCGAAGCACAGACGTTGACCGGACTTTGATGAGTGCTATGACAAACCTGGCAGCCCTGTTTCCCCCAGAAGGTGTCAGCATCTGGAATCCTATCCTACTCTGGCAGCCCATCCCGGTGCACACAGTTCCTCTTTCTGAAGATCAGTTGCTATACCTGCCTTTCAGGAACTGCCCTCGTTTTCAAGAACTTGAGAGTGAGACTTTGAAATCAGAGGAATTCCAGAAGAGGCTGCACCCTTATAAGGATTTTATAGCTACCTTGGGAAAACTTTCAGGATTACATGGCCAGGACCTTTTTGGAATTTGGAGTAAAGTCTACGACCCTTTATATTGTGAGAGTGTTCACAATTTCACTTTACCCTCCTGGGCCACTGAGGACACCATGACTAAGTTGAGAGAATTGTCAGAATTGTCCCTCCTGTCCCTCTATGGAATTCACAAGCAGAAAGAGAAATCTAGGCTCCAAGGGGGTGTCCTGGTCAATGAAATCCTCAATCACATGAAGAGAGCAACTCAGATACCAAGCTACAAAAAACTTATCATGTATTCTGCGCATGACACTACTGTGAGTGGCCTACAGATGGCGCTAGATGTTTACAACGGACTCCTTCCTCCCTATGCTTCTTGCCACTTGACGGAATTGTACTTTGAGAAGGGGGAGTACTTTGTGGAGATGCACTATCGGAATGAGACGCAGCACGAGCCGTATCCCCTCATGCTACCTGGCTGCAGCCCCAGCTGTCCTCTGGAGAGGTTTGCTGAGCTGGTTGGCCCTGTGATCCCTCAAGACTGGTCCACGGAGTGTATGACCACAAACAGCCATCAAGGTACTGAGGACAGTACAGATTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MRAAPLLLARAASLSLGFLFLLFFWLDRSVLAKELKFVTLVFRHGDRSPIDTFPTDPIKESSWPQGFGQLTQLGMEQHYELGEYIRKRYRKFLNESYKHEQVYIRSTDVDRTLMSAMTNLAALFPPEGVSIWNPILLWQPIPVHTVPLSEDQLLYLPFRNCPRFQELESETLKSEEFQKRLHPYKDFIATLGKLSGLHGQDLFGIWSKVYDPLYCESVHNFTLPSWATEDTMTKLRELSELSLLSLYGIHKQKEKSRLQGGVLVNEILNHMKRATQIPSYKKLIMYSAHDTTVSGLQMALDVYNGLLPPYASCHLTELYFEKGEYFVEMHYRNETQHEPYPLMLPGCSPSCPLERFAELVGPVIPQDWSTECMTTNSHQGTEDSTDYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.19|B|12 Available