hGUHO02604

DGRC Stock Number: 1661937

RRID: RRID:DGRC_1661937

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02604

When publishing experiments using hGUHO02604, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02604 (DGRC Stock 1661937 ; https://dgrc.bio.indiana.edu//stock/1661937 ; RRID:DGRC_1661937)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SLC25A6   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
sesB SLC25A6 9 No Yes
Ant2 SLC25A6 9 No Yes
Base Vector pGW-HA.attB
AA Size 376
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGACGGAACAGGCCATCTCCTTCGCCAAAGACTTCTTGGCCGGAGGCATCGCCGCCGCCATCTCCAAGACGGCCGTGGCTCCGATCGAGCGGGTCAAGCTGCTGCTGCAGGTCCAGCACGCCAGCAAGCAGATCGCCGCCGACAAGCAGTACAAGGGCATCGTGGACTGCATTGTCCGCATCCCCAAGGAGCAGGGCGTGCTGTCCTTCTGGAGGGGCAACCTTGCCAACGTCATTCGCTACTTCCCCACTCAAGCCCTCAACTTCGCCTTCAAGGATAAGTACAAGCAGATCTTCCTGGGGGGCGTGGACAAGCACACGCAGTTCTGGAGGTACTTTGCGGGCAACCTGGCCTCCGGCGGTGCGGCCGGCGCGACCTCCCTCTGCTTCGTGTACCCGCTGGATTTTGCCAGAACCCGCCTGGCAGCGGACGTGGGAAAGTCAGGCACAGAGCGCGAGTTCCGAGGCCTGGGAGACTGCCTGGTGAAGATCACCAAGTCCGACGGCATCCGGGGCCTGTACCAGGGCTTCAGTGTCTCCGTGCAGGGCATCATCATCTACCGGGCGGCCTACTTCGGCGTGTACGATACGGCCAAGGGCATGCTCCCCGACCCCAAGAACACGCACATCGTGGTGAGCTGGATGATCGCGCAGACCGTGACGGCCGTGGCCGGCGTGGTGTCCTACCCCTTCGACACGGTGCGGCGGCGCATGATGATGCAGTCCGGGCGCAAAGGAGCTGACATCATGTACACGGGCACCGTCGACTGTTGGAGGAAGATCTTCAGAGATGAGGGGGGCAAGGCCTTCTTCAAGGGTGCGTGGTCCAACGTCCTGCGGGGCATGGGGGGCGCCTTCGTGCTGGTCCTGTACGACGAGCTCAAGAAGGTGATCTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MTEQAISFAKDFLAGGIAAAISKTAVAPIERVKLLLQVQHASKQIAADKQYKGIVDCIVRIPKEQGVLSFWRGNLANVIRYFPTQALNFAFKDKYKQIFLGGVDKHTQFWRYFAGNLASGGAAGATSLCFVYPLDFARTRLAADVGKSGTEREFRGLGDCLVKITKSDGIRGLYQGFSVSVQGIIIYRAAYFGVYDTAKGMLPDPKNTHIVVSWMIAQTVTAVAGVVSYPFDTVRRRMMMQSGRKGADIMYTGTVDCWRKIFRDEGGKAFFKGAWSNVLRGMGGAFVLVLYDELKKVIYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.18|G|9 Available