hGUHO03719

DGRC Stock Number: 1661920

RRID: RRID:DGRC_1661920

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03719

When publishing experiments using hGUHO03719, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03719 (DGRC Stock 1661920 ; https://dgrc.bio.indiana.edu//stock/1661920 ; RRID:DGRC_1661920)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene DNAJB5   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG2887 DNAJB5 7 Yes No
DnaJ-1 DNAJB5 13 Yes No
CG5001 DNAJB5 14 Yes Yes
Base Vector pGW-HA.attB
AA Size 464
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGGAAAAGATTATTACAAGATTCTTGGGATCCCATCGGGGGCCAACGAGGATGAGATCAAGAAAGCCTACCGGAAGATGGCCTTGAAGTACCACCCAGACAAGAATAAAGAACCCAACGCTGAGGAGAAGTTTAAGGAGATTGCAGAGGCCTATGATGTGCTAAGTGACCCCAAGAAACGGGGCCTGTATGACCAGTATGGGGAGGAAGGCCTGAAGACCGGCGGTGGCACATCAGGTGGCTCCAGTGGCTCCTTTCACTACACCTTTCATGGGGACCCCCATGCCACCTTTGCCTCCTTCTTTGGTGGCTCCAACCCCTTCGATATCTTCTTTGCCAGCAGCCGCTCCACTCGGCCCTTCAGTGGCTTTGACCCAGATGACATGGATGTGGATGAAGATGAGGACCCATTTGGCGCTTTCGGCCGTTTTGGCTTCAATGGGCTGAGTAGGGGTCCAAGGCGAGCCCCAGAACCACTGTACCCTCGGCGCAAGGTGCAGGACCCCCCAGTGGTGCACGAGCTGCGGGTGTCCCTGGAGGAGATCTACCATGGCTCCACCAAGCGCATGAAGATCACAAGGCGTCGCCTCAACCCTGATGGGCGAACTGTGCGCACCGAGGACAAGATCCTGCACATAGTCATCAAGCGTGGCTGGAAGGAAGGCACCAAGATCACCTTCCCCAAAGAAGGCGACGCCACACCTGACAACATCCCTGCTGACATCGTCTTTGTGCTCAAAGACAAGCCCCATGCACACTTCCGCCGAGATGGCACCAACGTGCTCTACAGTGCCCTGATCAGCCTCAAGGAGGCGCTGTGTGGCTGCACTGTGAACATTCCCACTATCGACGGCCGAGTGATCCCTTTGCCCTGCAATGATGTCATCAAGCCAGGCACCGTGAAGAGACTCCGTGGGGAGGGCCTTCCCTTCCCCAAAGTGCCAACTCAGCGAGGAGACCTCATTGTTGAGTTCAAAGTTCGCTTCCCAGACAGATTAACACCACAGACAAGACAGATCCTTAAGCAGCAATACCCCCAACACTCACTCCACTCAATGTGCACCCAGCTTGATGTCCACTGGACACTGGCAACTTTTTCTAAAATGCAAAAAAAAGCCACTGGTTTTCAGGAAAATGTTCCTGTCCCTGACCCCTTTTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MGKDYYKILGIPSGANEDEIKKAYRKMALKYHPDKNKEPNAEEKFKEIAEAYDVLSDPKKRGLYDQYGEEGLKTGGGTSGGSSGSFHYTFHGDPHATFASFFGGSNPFDIFFASSRSTRPFSGFDPDDMDVDEDEDPFGAFGRFGFNGLSRGPRRAPEPLYPRRKVQDPPVVHELRVSLEEIYHGSTKRMKITRRRLNPDGRTVRTEDKILHIVIKRGWKEGTKITFPKEGDATPDNIPADIVFVLKDKPHAHFRRDGTNVLYSALISLKEALCGCTVNIPTIDGRVIPLPCNDVIKPGTVKRLRGEGLPFPKVPTQRGDLIVEFKVRFPDRLTPQTRQILKQQYPQHSLHSMCTQLDVHWTLATFSKMQKKATGFQENVPVPDPFYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.18|F|4 Available