hGUHO03061

DGRC Stock Number: 1661824

RRID: RRID:DGRC_1661824

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03061

When publishing experiments using hGUHO03061, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03061 (DGRC Stock 1661824 ; https://dgrc.bio.indiana.edu//stock/1661824 ; RRID:DGRC_1661824)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene TMEM185A   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG14194 TMEM185A 12 Yes Yes
Base Vector pGW-HA.attB
AA Size 428
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGAACCTGAGGGGCCTCTTCCAGGACTTCAACCCGAGTAAATTCCTCATCTATGCCTGTCTGCTGCTGTTCTCTGTGCTGCTGGCCCTTCGTTTGGATGGCATCATACAGTGGAGTTACTGGGCTGTCTTTGCTCCAATATGGCTGTGGAAGTTAATGGTCATTGTTGGAGCCTCAGTTGGAACTGGAGTCTGGGCACGAAATCCTCAATATCGAGCAGAAGGAGAAACGTGTGTGGAGTTTAAAGCCATGTTGATTGCAGTGGGCATCCACTTGCTCTTGTTGATGTTTGAAGTTCTGGTCTGTGACAGAATCGAGAGAGGAAGCCATTTCTGGCTCCTGGTCTTCATGCCGCTGTTCTTTGTTTCCCCGGTGTCTGTTGCAGCTTGCGTTTGGGGCTTTCGACATGACAGGTCACTAGAGTTAGAAATCCTGTGTTCTGTCAACATTCTCCAGTTTATATTCATTGCCTTAAGACTGGACAAGATCATCCACTGGCCCTGGCTTGTTGTGTGTGTCCCGCTGTGGATTCTCATGTCCTTTCTGTGCCTGGTGGTCCTCTACTACATTGTGTGGTCCGTCTTGTTCTTGCGCTCTATGGATGTGATTGCGGAGCAGCGCAGGACACACATAACCATGGCCCTGAGCTGGATGACCATCGTCGTGCCCCTTCTTACATTTGAGATTCTGCTGGTTCACAAACTGGATGGCCACAACGCCTTCTCCTGCATCCCGATCTTTGTCCCCCTTTGGCTCTCGTTGATCACGCTGATGGCAACCACATTTGGACAGAAGGGAGGAAACCACTGGTGGTTTGGTATCCGCAAAGATTTCTGTCAGTTTCTGCTTGAAATCTTCCCATTTCTACGAGAATATGGAAACATTTCCTATGATCTCCATCACGAAGATAATGAAGAAACCGAAGAGACCCCAGTTCCGGAGCCCCCTAAAATCGCACCCATGTTTCGAAAGAAGGCCAGGGTGGTCATTACCCAGAGCCCTGGGAAGTATGTGCTCCCACCTCCCAAATTAAATATCGAAATGCCAGATTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MNLRGLFQDFNPSKFLIYACLLLFSVLLALRLDGIIQWSYWAVFAPIWLWKLMVIVGASVGTGVWARNPQYRAEGETCVEFKAMLIAVGIHLLLLMFEVLVCDRIERGSHFWLLVFMPLFFVSPVSVAACVWGFRHDRSLELEILCSVNILQFIFIALRLDKIIHWPWLVVCVPLWILMSFLCLVVLYYIVWSVLFLRSMDVIAEQRRTHITMALSWMTIVVPLLTFEILLVHKLDGHNAFSCIPIFVPLWLSLITLMATTFGQKGGNHWWFGIRKDFCQFLLEIFPFLREYGNISYDLHHEDNEETEETPVPEPPKIAPMFRKKARVVITQSPGKYVLPPPKLNIEMPDLPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCACCATGAACCTGAGGGGCCTCTTCCAGGACTTCAACCCGAGTAAATTCCTCATCTATGCCTGTCTGCTGCTGTTCTCTGTGCTGCTGGCCCTTCGTTTGGATGGCATCATACAGTGGAGTTACTGGGCTGTCTTTGCTCCAATATGGCTGTGGAAGTTAATGGTCATTGTTGGAGCCTCAGTTGGAACTGGAGTCTGGGCACGAAATCCTCAATATCGAGCAGAAGGAGAAACGTGTGTGGAGTTTAAAGCCATGTTGATTGCAGTGGGCATCCACTTGCTCTTGTTGATGTTTGAAGTTCTGGTCTGTGACAGAATCGAGAGAGGAAGCCATTTCTGGCTCCTGGTCTTCATGCCGCTGTTCTTTGTTTCCCCGGTGTCTGTTGCAGCTTGCGTTTGGGGCTTTCGACATGACAGGTCACTAGAGTTAGAAATCCTGTGTTCTGTCAACATTCTCCAGTTTATATTCATTGCCTTAAGACTGGACAAGATCATCCACTGGCCCTGGCTTGTTGTGTGTGTCCCGCTGTGGATTCTCATGTCCTTTCTGTGCCTGGTGGTCCTCTACTACATTGTGTGGTCCGTCTTGTTCTTGCGCTCTATGGATGTGATTGCGGAGCAGCGCAGACACACATAACCATGGCCCTGAGCTGGATGACCATCGTCGTGCCCCTTCTTACATTTGAGATTCTGCTGGTTCACAAACTGGATGGCCACAACGCCTTCTCCTGCATCCCGATCTTTGTCCCCCTTTGGCTCTCGTTGATCACGCTGATGGCAACCACATTTGGACAGAAGGAGGAAACCACTGGTGGTTTGGTATCCGCAAAGATTTCTTGTCAGTTCTGCTTGAAATCTTCCATTTCTACGAGAATATGGAAACATTTCTATGATCTCCATCACGAGATATGAGAACGAGAGACCCAGTCCGACCTAATCGCACCATGTTTCGAAGAAGCAGTGTCATTACCTAGGTCT
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.17|F|4 Available