hGUHO02501

DGRC Stock Number: 1661699

RRID: RRID:DGRC_1661699

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02501

When publishing experiments using hGUHO02501, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02501 (DGRC Stock 1661699 ; https://dgrc.bio.indiana.edu//stock/1661699 ; RRID:DGRC_1661699)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene NMNAT1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Nmnat NMNAT1 12 No Yes
Base Vector pGW-HA.attB
AA Size 357
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGAAAATTCCGAGAAGACTGAAGTGGTTCTCCTTGCTTGTGGTTCATTCAATCCCATCACCAACATGCACCTCAGGTTGTTTGAGCTGGCCAAGGACTACATGAATGGAACAGGAAGGTACACAGTTGTCAAAGGCATCATCTCTCCTGTTGGTGATGCCTACAAGAAGAAAGGACTCATTCCTGCCTATCACCGGGTCATCATGGCAGAACTTGCTACCAAGAATTCTAAATGGGTGGAAGTTGATACATGGGAAAGTCTTCAGAAGGAGTGGAAAGAGACTCTGAAGGTGCTAAGACACCATCAAGAGAAATTGGAGGCTAGTGACTGTGATCACCAGCAGAACTCACCTACTCTAGAAAGGCCTGGAAGGAAGAGGAAGTGGACTGAAACACAAGATTCTAGTCAAAAGAAATCCCTAGAGCCAAAAACAAAAGCTGTGCCAAAGGTCAAGCTGCTGTGTGGGGCAGATTTATTGGAGTCCTTTGCTGTTCCCAATTTGTGGAAGAGTGAAGACATCACCCAAATCGTGGCCAACTATGGGCTCATATGTGTTACTCGGGCTGGAAATGATGCTCAGAAGTTTATCTATGAATCGGATGTGCTGTGGAAACACCGGAGCAACATTCACGTGGTGAATGAATGGATCGCTAATGACATCTCATCCACAAAAATCCGGAGAGCCCTCAGAAGGGGCCAGAGCATTCGCTACTTGGTACCAGATCTTGTCCAAGAATACATTGAAAAGCATAATTTGTACAGCTCTGAGAGTGAAGACAGGAATGCTGGGGTCATCCTGGCCCCTTTGCAGAGAAACACTGCAGAAGCTAAGACATACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MENSEKTEVVLLACGSFNPITNMHLRLFELAKDYMNGTGRYTVVKGIISPVGDAYKKKGLIPAYHRVIMAELATKNSKWVEVDTWESLQKEWKETLKVLRHHQEKLEASDCDHQQNSPTLERPGRKRKWTETQDSSQKKSLEPKTKAVPKVKLLCGADLLESFAVPNLWKSEDITQIVANYGLICVTRAGNDAQKFIYESDVLWKHRSNIHVVNEWIANDISSTKIRRALRRGQSIRYLVPDLVQEYIEKHNLYSSESEDRNAGVILAPLQRNTAEAKTYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.16|C|11 Available