hGUHO03410

DGRC Stock Number: 1661299

RRID: RRID:DGRC_1661299

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03410

When publishing experiments using hGUHO03410, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03410 (DGRC Stock 1661299 ; https://dgrc.bio.indiana.edu//stock/1661299 ; RRID:DGRC_1661299)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene FLAD1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG4407 FLAD1 12 Yes Yes
CG16848 FLAD1 11 Yes No
Base Vector pGW-HA.attB
AA Size 568
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGACATCTAGGGCCTCTGAACTTTCTCCGGGGCGCAGCGTGACGGCTGGCATCATCATTGTTGGAGATGAGATCCTTAAGGGACACACTCAGGACACCAACACCTTCTTTCTGTGCCGGACACTGCGCTCCCTAGGGGTCCAGGTTTGCCGAGTCTCAGTTGTACCTGATGAGGTAGCCACCATTGCAGCTGAGGTCACTTCTTTCTCCAACCGCTTCACCCATGTCCTCACAGCAGGGGGCATCGGCCCCACTCATGATGATGTGACCTTTGAGGCAGTGGCACAGGCCTTTGGAGATGAGCTGAAGCCACACCCCAAGTTGGAAGCAGCCACCAAAGCCCTAGGAGGGGAAGGCTGGGAGAAGCTATCATTGGTGCCCTCCTCTGCCCGCCTGCATTATGGCACAGATCCTTGCACTGGTCAACCTTTCAGATTCCCTCTGGTCTCCGTCCGAAACGTCTACCTCTTCCCAGGCATTCCAGAGCTGCTGCGGCGGGTGCTGGAGGGGATGAAGGGACTATTCCAAAACCCAGCTGTTCAGTTCCACTCAAAGGAGCTATATGTGGCTGCTGATGAAGCCTCCATCGCCCCCATTCTGGCTGAGGCCCAGGCCCACTTTGGACGTAGGCTTGGCCTGGGTTCCTACCCTGACTGGGGCAGCAACTACTATCAGGTGAAGCTGACTCTAGACTCAGAGGAAGAAGGACCCCTGGAGGAATGCTTGGCCTACCTGACTGCCCGTTTGCCCCAGGGATCGCTGGTCCCCTACATGCCCAACGCTGTGGAGCAGGCCAGTGAGGCTGTATACAAACTCGCTGAATCAGGGTCTTCTTTGGGGAAAAAGGTGGCAGGTGCCCTACAGACCATTGAGACCTCCCTGGCTCAGTACAGCCTCACCCAGCTCTGTGTGGGCTTCAACGGGGGCAAAGACTGCACTGCCCTCCTGCACCTCTTCCATGCAGCTGTGCAGAGGAAATTACCTGATGTTCCAAACCCCCTCCAGATCCTGTATATCCGCAGCATCTCCCCTTTCCCTGAGCTGGAACAGTTTCTACAGGACACTATCAAGAGGTATAATCTGCAGATGTTGGAAGCTGAGGGCAGCATGAAGCAGGCCCTGGGTGAACTGCAGGCACGGCACCCCCAGCTGGAGGCTGTCCTTATGGGCACCCGCCGGACTGACCCCTACTCCTGTAGCCTCTGCCCTTTCAGCCCCACTGACCCAGGCTGGCCCGCATTCATGCGCATCAACCCACTGCTGGACTGGACCTACAGAGACATCTGGGATTTTCTGCGTCAGCTGTTTGTCCCATACTGTATCCTGTATGACCGAGGATACACATCACTGGGGAGTCGGGAGAATACCGTGCGGAACCCGGCCCTGAAGTGCCTGAGCCCAGGAGGACACCCCACATACCGTCCAGCCTATCTACTGGAGAACGAAGAAGAGGAGCGGAACTCCCGCACATGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MTSRASELSPGRSVTAGIIIVGDEILKGHTQDTNTFFLCRTLRSLGVQVCRVSVVPDEVATIAAEVTSFSNRFTHVLTAGGIGPTHDDVTFEAVAQAFGDELKPHPKLEAATKALGGEGWEKLSLVPSSARLHYGTDPCTGQPFRFPLVSVRNVYLFPGIPELLRRVLEGMKGLFQNPAVQFHSKELYVAADEASIAPILAEAQAHFGRRLGLGSYPDWGSNYYQVKLTLDSEEEGPLEECLAYLTARLPQGSLVPYMPNAVEQASEAVYKLAESGSSLGKKVAGALQTIETSLAQYSLTQLCVGFNGGKDCTALLHLFHAAVQRKLPDVPNPLQILYIRSISPFPELEQFLQDTIKRYNLQMLEAEGSMKQALGELQARHPQLEAVLMGTRRTDPYSCSLCPFSPTDPGWPAFMRINPLLDWTYRDIWDFLRQLFVPYCILYDRGYTSLGSRENTVRNPALKCLSPGGHPTYRPAYLLENEEEERNSRTCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.12|B|7 Available