TfBAC00270
DGRC Stock Number: 1660787 RRID: RRID:DGRC_1660787 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00270
When publishing experiments using TfBAC00270, please include the following details in your manuscript.
- Materials and Methods
TfBAC00270 (DGRC Stock 1660787 ; https://dgrc.bio.indiana.edu//stock/1660787 ; RRID:DGRC_1660787)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | srp (FBgn0003507) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | srp AV007 |
BAC | CH321-43B5 |
Tag | AV007 |
50bp Preceding Tag | ATGCGATGCATAAGTTCGGCGTTGACCGGGAAACAGTGGTGAAGATGGAG |
Tagged Transcripts |
FBtr0083216 FBtr0083215 FBtr0100595 FBtr0306244 FBtr0335423 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC2|F|10 | Available |