TfBAC00237
|
DGRC Stock Number: 1660754 RRID: RRID:DGRC_1660754 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00237
When publishing experiments using TfBAC00237, please include the following details in your manuscript.
- Materials and Methods
TfBAC00237 (DGRC Stock 1660754 ; https://dgrc.bio.indiana.edu//stock/1660754 ; RRID:DGRC_1660754)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | psq (FBgn0263102) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | psq-RI AV7 |
| BAC | CH321-61B16 |
| Tag | AV007 |
| 50bp Preceding Tag | AGCAGCAGCTTCAGCAGATCTATCAGCACCACGGGACGCCGGAGCGTAGT |
| Tagged Transcripts |
FBtr0088276 FBtr0088277 FBtr0088281 FBtr0088278 FBtr0088280 FBtr0088282 FBtr0100606 FBtr0088279 FBtr0088275 FBtr0100607 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC2|D|1 | Available |
