TfBAC00216
DGRC Stock Number: 1660733 RRID: RRID:DGRC_1660733 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00216
When publishing experiments using TfBAC00216, please include the following details in your manuscript.
- Materials and Methods
TfBAC00216 (DGRC Stock 1660733 ; https://dgrc.bio.indiana.edu//stock/1660733 ; RRID:DGRC_1660733)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | Mondo (FBgn0032940) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | Mio AV7 |
BAC | CH321-23K15 |
Tag | AV007 |
50bp Preceding Tag | CCAAAGCCCTCCAGAATTCAAGTGGCCAGCATCCAAATCTGCATGGACCC |
Tagged Transcripts |
FBtr0081527 FBtr0081524 FBtr0081525 FBtr0301457 FBtr0301458 FBtr0301459 FBtr0301460 FBtr0301461 FBtr0301462 FBtr0301463 FBtr0301464 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC2|B|4 | Available |