TfBAC00171
|
DGRC Stock Number: 1660692 RRID: RRID:DGRC_1660692 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00171
When publishing experiments using TfBAC00171, please include the following details in your manuscript.
- Materials and Methods
TfBAC00171 (DGRC Stock 1660692 ; https://dgrc.bio.indiana.edu//stock/1660692 ; RRID:DGRC_1660692)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | gro (FBgn0001139) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | CH322-43E01 Gro AV001 |
| BAC | CH322-43E1 |
| Tag | AV001 |
| 50bp Preceding Tag | TTGTGACGGGTTCGGGCGATAAGAAGGCTACTGTCTACGAAGTTATTTAT |
| Tagged Transcripts |
FBtr0084962 FBtr0084963 FBtr0084964 FBtr0084965 FBtr0084966 FBtr0302951 FBtr0302952 FBtr0305047 FBtr0337057 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC1|F|11 | Available |
