TfBAC00164
DGRC Stock Number: 1660685 RRID: RRID:DGRC_1660685 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00164
When publishing experiments using TfBAC00164, please include the following details in your manuscript.
- Materials and Methods
TfBAC00164 (DGRC Stock 1660685 ; https://dgrc.bio.indiana.edu//stock/1660685 ; RRID:DGRC_1660685)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | chn (FBgn0015371) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | "chn-RC AV7, CH321-52N13" |
BAC | CH321-52N13 |
Tag | AV007 |
50bp Preceding Tag | TGCAGGCAGCTCTGCAGAAGAGGATTAGCCGAGGACAGGCGGACAAATGC |
Tagged Transcripts |
FBtr0111006 FBtr0087415 FBtr0087416 FBtr0305213 FBtr0305214 FBtr0305215 FBtr0305216 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC1|F|4 | Available |