hGUHO14235
|
DGRC Stock Number: 1667696 RRID: RRID:DGRC_1667696 Donor: BDGP This clones has been validated by BDGP. 3' end sequencing has confirmedq the tag exists in-frame with at least the last several bases of the ORF. |
No Image Available
Price: $63.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite hGUHO14235
When publishing experiments using hGUHO14235, please include the following details in your manuscript.
- Materials and Methods
hGUHO14235 (DGRC Stock 1667696 ; https://dgrc.bio.indiana.edu//stock/1667696 ; RRID:DGRC_1667696)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Homo sapiens | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Collections |
Human ORF |
||||||||||||
| Human Gene | CORO2A ( Entrez , HGNC ) | ||||||||||||
| Orthology |
|
||||||||||||
| Base Vector | pGW-HA.attB | ||||||||||||
| Tag Info | 3xHA | ||||||||||||
| Sequenced 3' End | TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG |
| Collection | Well | Status | Note |
|---|---|---|---|
| Human ORF | HumanORF hGUHO-RA.55|B|11 | Available |