hGUHO14235
RRID:DGRC_1667696
|
Donor: BDGP Clone Summary: Human cDNA in UAS vectors Sequence Availability: End Sequenced Species: Homo sapiens Base Vector: pGW-HA.attB Collection: Human ORF This clones has been validated by BDGP. 3' end sequencing has confirmed the tag exists in-frame with at least the last several bases of the ORF. |
No Image Available
Price: $63.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite hGUHO14235
When publishing experiments using hGUHO14235, please include the following details in your manuscript.
- Materials and Methods
hGUHO14235 (RRID:DGRC_1667696 ; https://dgrc.bio.indiana.edu//stock/RRID:DGRC_1667696)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Tag | 3xHA | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Human Gene | CORO2A ( Entrez , HGNC ) | ||||||||||||||||||
| Orthology |
|
||||||||||||||||||
| Sequenced 3' End | TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG |
| Collection | Well | Status | Note |
|---|---|---|---|
| Human ORF | HumanORF hGUHO-RA.55|B11 | Available |
