B66-sg1
|
DGRC Stock Number: 1664782 RRID: RRID:DGRC_1664782 Donor: R. Padinjat |
No Image Available
Price: $60.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite B66-sg1
When publishing experiments using B66-sg1, please include the following details in your manuscript.
- Materials and Methods
B66-sg1 (DGRC Stock 1664782 ; https://dgrc.bio.indiana.edu//stock/1664782 ; RRID:DGRC_1664782)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
- Trivedi et al., 2020
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | AP-1gamma (FBgn0030089) |
| Collections |
Phosphoinositide signaling gRNA Library |
| Vector | pBFv6.2 |
| sg1 | CACCTGCGATTGTTCTCCGGCGG |
| Collection | Well | Status | Note |
|---|---|---|---|
| Phosphoinositide signaling gRNA Library | NCBSgRNA Plate 4|B|1 | Available |
