B55-sg2
DGRC Stock Number: 1664753 RRID: RRID:DGRC_1664753 Donor: R. Padinjat |
No Image Available
Price: $60.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite B55-sg2
When publishing experiments using B55-sg2, please include the following details in your manuscript.
- Materials and Methods
B55-sg2 (DGRC Stock 1664753 ; https://dgrc.bio.indiana.edu//stock/1664753 ; RRID:DGRC_1664753)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
- Trivedi et al., 2020
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | rush (FBgn0025381) |
Collections |
Phosphoinositide signaling gRNA Library |
Vector | pBFv6.2B |
sg2 | TGGACGCTCGGTGTCACCTGGGG |
Collection | Well | Status | Note |
---|---|---|---|
Phosphoinositide signaling gRNA Library | NCBSgRNA Plate 3|G|8 | Available |