B37-sg1
DGRC Stock Number: 1664722 RRID: RRID:DGRC_1664722 Donor: R. Padinjat |
No Image Available
Price: $60.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite B37-sg1
When publishing experiments using B37-sg1, please include the following details in your manuscript.
- Materials and Methods
B37-sg1 (DGRC Stock 1664722 ; https://dgrc.bio.indiana.edu//stock/1664722 ; RRID:DGRC_1664722)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
- Trivedi et al., 2020
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | Sep4 (FBgn0259923) |
Collections |
Phosphoinositide signaling gRNA Library |
Vector | pBFv6.2 |
sg1 | ATGGGCGCTACAGCGGCGGGGGG |
Collection | Well | Status | Note |
---|---|---|---|
Phosphoinositide signaling gRNA Library | NCBSgRNA Plate 3|E|1 | Available |