hGUHO05391

DGRC Stock Number: 1662523

RRID: RRID:DGRC_1662523

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO05391

When publishing experiments using hGUHO05391, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO05391 (DGRC Stock 1662523 ; https://dgrc.bio.indiana.edu//stock/1662523 ; RRID:DGRC_1662523)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene LCA5L   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG6652 LCA5L 6 No Yes
Base Vector pGW-HA.attB
AA Size 748
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGTCTTTGGCTGATCTAACAAAAACAAATATAGATGAGCATTTCTTCGGCGTGGCATTAGAAAACAATAGGAGGTCTGCAGCATGCAAGAGAAGCCCAGGCACAGGCGATTTTTCACGGAACAGTAATGCTTCCAATAAGAGTGTTGATTATAGCAGATCTCAGTGCTCCTGTGGAAGTTTAAGTTCTCAGTATGATTATTCAGAAGACTTTCTCTGTGATTGTTCAGAAAAGGCTATTAATAGAAATTATTTAAAGCAGCCTGTGGTAAAAGAAAAGGAGAAGAAAAAGTATAATGTTTCTAAAATCTCCCAATCTAAAGGCCAGAAGGAAATATCAGTTGAAAAAAAGCACACCTGGAATGCATCACTCTTTAATTCTCAAATCCATATGATTGCCCAAAGAAGAGATGCTATGGCTCATCGAATACTCTCAGCAAGGCTTCATAAAATTAAAGGACTAAAAAATGAATTAGCTGATATGCATCATAAATTGGAAGCCATCCTTACAGAAAACCAATTTTTGAAACAACTTCAGCTTAGGCATTTGAAAGCTATAGGAAAATATGAGAATTCACAAAATAATCTACCTCAAATTATGGCTAAACATCAGAATGAAGTAAAAAATTTAAGGCAACTACTTAGGAAATCCCAGGAAAAGGAAAGAACTCTATCTAGGAAACTTAGAGAAACTGACAGCCAGTTACTGAAGACTAAAGATATCTTGCAGGCACTGCAGAAACTTTCTGAAGACAAAAACCTTGCAGAAAGGGAAGAACTCACTCATAAATTATCTATTATCACAACAAAAATGGACGCAAATGACAAAAAAATACAGAGCTTGGAAAAACAACTGAGGTTGAACTGCAGAGCCTTTAGCCGGCAGCTGGCTATTGAGACTCGGAAGACTTTAGCAGCTCAGACAGCTACCAAGACTCTGCAGGTGGAAGTAAAACACCTTCAACAAAAACTTAAGGAAAAGGATCGTGAGCTTGAAATTAAAAACATCTATAGTCATCGAATACTTAAAAATTTACATGACACAGAGGACTATCCAAAAGTTTCTTCAACAAAATCAGTCCAAGCAGACAGAAAAATTTTGCCATTCACAAGTATGAGACACCAGGGAACCCAAAAATCAGATGTTCCACCTTTGACAACTAAGGGTAAAAAGGCAACAGGAAACATCGATCATAAAGAAAAATCAACTGAAATAAATCATGAAATTCCTCACTGTGTGAATAAACTACCAAAGCAAGAGGATTCTAAGAGAAAATATGAAGATTTATCAGGGGAAGAGAAACATTTGGAAGTCCAAATACTGCTGGAGAATACTGGAAGACAAAAAGACAAAAAAGAAGACCAAGAAAAGAAAAACATTTTTGTGAAAGAAGAGCAAGAACTACCACCAAAAATAATTGAAGTTATTCATCCTGAAAGAGAAAGCAATCAAGAAGATGTTCTAGTAAGAGAAAAGTTTAAAAGAAGCATGCAGAGAAATGGTGTGGATGACACACTTGGCAAAGGCACTGCTCCCTACACGAAAGGCCCCCTCAGACAAAGAAGACATTACTCATTCACAGAAGCAACTGAAAACCTGCATCATGGGCTTCCTGCTTCAGGGGGGCCAGCCAATGCCGGCAACATGAGGTACAGTCATAGTACAGGCAAGCATCTCAGTAACAGAGAGGAAATGGAGCTAGAGCATTCTGACAGTGGGTATGAGCCCTCATTTGGTAAGTCTTCCAGAATAAAAGTGAAGGATACAACTTTCAGAGATAAGAAAAGCAGTCTCATGGAAGAACTCTTTGGATCAGGCTATGTCTTGAAAACTGACCAATCAAGTCCTGGTGTTGCAAAAGGCTCAGAGGAGCCTTTGCAAAGTAAGGAGTCGCATCCCCTGCCTCCCAGTCAGGCCTCCACCAGCCATGCTTTCGGAGACTCTAAAGTAACTGTGGTAAATTCTATTAAGCCATCGTCACCTACAGAAGGAAAAAGAAAAATAATTATTTACCCAACCTACTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSLADLTKTNIDEHFFGVALENNRRSAACKRSPGTGDFSRNSNASNKSVDYSRSQCSCGSLSSQYDYSEDFLCDCSEKAINRNYLKQPVVKEKEKKKYNVSKISQSKGQKEISVEKKHTWNASLFNSQIHMIAQRRDAMAHRILSARLHKIKGLKNELADMHHKLEAILTENQFLKQLQLRHLKAIGKYENSQNNLPQIMAKHQNEVKNLRQLLRKSQEKERTLSRKLRETDSQLLKTKDILQALQKLSEDKNLAEREELTHKLSIITTKMDANDKKIQSLEKQLRLNCRAFSRQLAIETRKTLAAQTATKTLQVEVKHLQQKLKEKDRELEIKNIYSHRILKNLHDTEDYPKVSSTKSVQADRKILPFTSMRHQGTQKSDVPPLTTKGKKATGNIDHKEKSTEINHEIPHCVNKLPKQEDSKRKYEDLSGEEKHLEVQILLENTGRQKDKKEDQEKKNIFVKEEQELPPKIIEVIHPERESNQEDVLVREKFKRSMQRNGVDDTLGKGTAPYTKGPLRQRRHYSFTEATENLHHGLPASGGPANAGNMRYSHSTGKHLSNREEMELEHSDSGYEPSFGKSSRIKVKDTTFRDKKSSLMEELFGSGYVLKTDQSSPGVAKGSEEPLQSKESHPLPPSQASTSHAFGDSKVTVVNSIKPSSPTEGKRKIIIYPTYLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCATGTCTTTGGCTGATCTAACAAAAACAAATATAGATGAGCATTTCTTCGGCGTGGCATTAGAAAACAATAGGAGGTCTGCAGCATGCAAGAGAAGCCCAGGCACAGGCGATTTTTCACGGAACAGTAATGCTTCCAATAAGAGTGTTGATTATAGCAGATCTCAGTGCTCCTGTGGAAGTTTAAGTTCTCAGTATGATTATTCAGAAGACTTTCTCTGTGATTGTTCAGAAAAGGCTATTAATAGAAATTATTTAAAGCAGCCTGTGGTAAAAGAAAAGGAGAAGAAAAAGTATAATGTTTCTAAAATCTCCCAATCTAAAGGCCAGAAGGAAATATCAGTTGAAAAAAAGCACACCTGGAATGCATCACTCTTTAATTCTCAAATCCATATGATTGCCCAAAGAAGAGATGCTATGGCTCATCGAATACTCTCAGCAAGGCTTCATAAAATTAAAGGACTAAAAAATGAATTAGCTGATATGCATCATAAATTGGAAGCCATCCTTACAGAAAACCAATTTTTGAAACAACTTCAGCTTAGGCATTTGAAAGCTATAGGAAAATATGAGAATTCACAAAATAATCTACCTCAAATTATGGCTAAACATCAGAATGAAGTAAAAAATTTAACGCAACTACTTAGGAAATCCCAGGAAAAGGAAAGAACTCTATCTAGGAAACTTAGAGAAACTGACAGCCAGTTACTGAAGACTAAAGATATCTTGCAGGCACTGCAGAAACTTTCTGAAGACAAAAACCTTGCAGAAAGGGAAGAACTCACTCATAAATTATCTATTATCACACAAAAATGGACGCAAATGACAAAAAAATACAGAGCTTGAAAAACACTGAAGTTGAACTGCAGAGCCTTTAGCGGCAGCTGGCTATTGAGACTCGGAAGACTTTAGCAGCTCAGACAGCTACCAAGACTCTGCAGGTGAAGTAAAACCCCTTTCAACAAAAACTTAGGAAAGATCGGTGAGCTGGAATTTAAAATCTAAGGTCATCGGATACCTTAAATTA
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.24|H|7 Available