hGUHO05360

DGRC Stock Number: 1662517

RRID: RRID:DGRC_1662517

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO05360

When publishing experiments using hGUHO05360, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO05360 (DGRC Stock 1662517 ; https://dgrc.bio.indiana.edu//stock/1662517 ; RRID:DGRC_1662517)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene EEF1D   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
eEF1delta EEF1D 10 Yes Yes
Base Vector pGW-HA.attB
AA Size 725
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAGGAGCGGGAAGGCCTCCTGCACCCTGGAGACCGTGTGGGAAGACAAGCACAAGTATGAGGAGGCCGAGCGGCGCTTCTACGAACACGAGGCCACACAGGCGGCCGCCTCCGCCCAGCAGCTGCCAGCCGAGGGGCCAGCCATGAATGGGCCCGGCCAGGACGACCCTGAGGACGCTGATGAGGCGGAAGCCCCTGACGGCGGCAGCAGGCGTGATCCCAGGAAGAGCCAGGACAGCAGGAAGCCCCTGCAGAAAAAGAGGAAGCGCTCCCCCAAGAGCGGGCTCGGCCCCGCGGACCTGGCCCTCCTGGGCCTCTCGGCCGAACGTGTGTGGCTGGACAAGTCACTTTTCGACCAGGCAGAGAGCTCCTACCGCCAGAAGCTGGCAGATGTGGCTGCCCAGGCAGCCTGGCCTCCTGCCTTGGCCCCTTGGGGTCTCTGCACCCATGGAAACCAGGTGGCCTGCCACCACGTGACCTGGGGGATCTGGGTCAACAAGTCCTCCTTCGACCAGGCTGAGCGGGCCTTCGTGGAGTGGTCTCAGGCCCTGTTGCTGGCCCCCGAGGGCAGCCGCAGGCAGGGGACTCCCAACACAGGCCAGCAGGTGGCCGTCCCCGACCTGGCCCACCAGCCCAGCCCACCGGTCAATGGCCAGCCCCCGCTGGGCAGCCTGCAGGCACTGGTTCGGGAGGTGTGGCTGGAGAAGCCCCGGTATGATGCAGCCGAGAGGGGCTTCTACGAGGCCCTGTTTGACGGCCATCCCCCAGGGAAGGTGCGCCTGCAAGAGCGAGCCGGCCTGGCCGAGGGTGCCCGGCGGGGCCGCAGAGACCGGCGGGGCCGCAACATCTTAGGGAACAAGCGGGCCGGGCTGCGACGGGCCGATGGGGAGGCCCCCTCTGCCTTGCCCTACTGTTACTTCCTGCAGAAGGATGCAGAGGCCCCCTGGCTCAGCAAGCCTGCCTACGACAGCGCCGAGTGCCGCCACCACGCTGCCGAGGCCCTGCGTGTGGCCTGGTGCCTCGAAGCTGCCTCCCTGTCTCACCGACCCGGTCCTCGGTCTGGCCTGTCCGTGTCCAGCCTGAGACCCAACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MRSGKASCTLETVWEDKHKYEEAERRFYEHEATQAAASAQQLPAEGPAMNGPGQDDPEDADEAEAPDGGSRRDPRKSQDSRKPLQKKRKRSPKSGLGPADLALLGLSAERVWLDKSLFDQAESSYRQKLADVAAQAAWPPALAPWGLCTHGNQVACHHVTWGIWVNKSSFDQAERAFVEWSQALLLAPEGSRRQGTPNTGQQVAVPDLAHQPSPPVNGQPPLGSLQALVREVWLEKPRYDAAERGFYEALFDGHPPGKVRLQERAGLAEGARRGRRDRRGRNILGNKRAGLRRADGEAPSALPYCYFLQKDAEAPWLSKPAYDSAECRHHAAEALRVAWCLEAASLSHRPGPRSGLSVSSLRPNRKMATNFLAHEKIWFDKFKYDDAERRFYEQMNGPVAGASRQENGASVILRDIARARENIQKSLAGSSGPGASSGTSGDHGELVVRIASLEVENQSLRGVVQELQQAISKLEARLNVLEKSSPGHRATAPQTQHVSPMRQVEPPAKKPATPAEDDEDDDIDLFGSDNEEEDKEAAQLREERLRQYAEKKAKKPALVAKSSILLDVKPWDDETDMAQLEACVRSIQLDGLVWGASKLVPVGYGIRKLQIQCVVEDDKVGTDLLEEEITKFEEHVQSVDIAAFNKICPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCATGAGGAGCGGGAAGGCCTCCTGCACCCTGGAGACCGTGTGGGAAGACAAGCACAAGTATGAGGAGGCCGAGCGGCGCTTCTACGAACACGAGGCCACACAGGCGGCCGCCTCCGCCCAGCAGCTGCCAGCCGAGGGGCCAGCCATGAATGGGCCCGGCCAGGACGACCCTGAGGACGCTGATGAGGCGGAAGCCCCTGACGGCGGCAGCAGGCGTGATCCCAGGAAGAGCCAGGACAGCAGGAAGCCCCTGCAGAAAAAGAGGAAGCGCTCCCCCAAGAGCGGGCTCGGCCCCGCGGACCTGGCCCTCCTGGGCCTCTCGGCCGAACGTGTGTGGCTGGACAAGTCACTTTTCGACCAGGCAGAGAGCTCCTACCGCCAGAAGCTGGCAGATGTGGCTGCCCAGGCAGCCTGGCCTCCTGCCTTGGCCCCTTGGGGTCTCTGCACCCATGGAAACCAGGTGGCCTGCCACCACGTGACCTGGGGGATCTGGGTCAACAAGTCCTCCTTCGACCAGGCTGAGCGGGCCTTCGTGGAGTGGTCTCAGGCCCTGTTGCTGGCCCCCGAGGGCAGCCGCAGGCAGGGGACTCCCAACACAGGCCAGCAGGTGGCCGTCCCCGACCTGGCCCACCAGCCCAGCCCACCGGTCAATGGCCAGCCCCCGCTGGGCAGCCTGCAGCACTGGTTTCGGGAGGTGTGGCTGGAGAAGCCCCGGTATGATGCAGCCGAGAGGGGCTTCTACGAGGCCCTGTTTGACGGCCATCCCCCAGGGAAAGTGCGCCTGCAAGAGCGAGCCGGCCTGCCGAGGTGCCCGGCGGGGCCGCAGAGACCGGCGGGCCGCAACATCTTAGGGAACAAGCGGGCCGGGCTGCGACGGGCGATGGGGAGGCCCCTCTGCTGCCCTACTGTACTCTGCAGAGATGCAGAGGCCCCTGGCTCAGCAGCCTGCTACGACGCGCCGAGGTGCCGCCACCAACGCCTGT
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.24|H|1 Available