hGUHO05088

DGRC Stock Number: 1662460

RRID: RRID:DGRC_1662460

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO05088

When publishing experiments using hGUHO05088, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO05088 (DGRC Stock 1662460 ; https://dgrc.bio.indiana.edu//stock/1662460 ; RRID:DGRC_1662460)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SLC5A8   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG9657 SLC5A8 7 Yes No
CG32669 SLC5A8 12 Yes Yes
CG42235 SLC5A8 6 Yes No
CG33124 SLC5A8 7 Yes No
CG31668 SLC5A8 6 Yes No
SLC5A11 SLC5A8 6 Yes No
CG6723 SLC5A8 7 Yes No
CG31262 SLC5A8 6 Yes No
Smvt SLC5A8 6 Yes No
salt SLC5A8 6 Yes No
Base Vector pGW-HA.attB
AA Size 688
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGGACACGCCACGGGGCATCGGCACCTTCGTGGTGTGGGACTACGTGGTGTTCGCGGGCATGCTGGTCATCTCGGCCGCCATCGGCATCTACTACGCCTTCGCTGGGGGCGGCCAGCAGACCTCCAAGGACTTCCTGATGGGCGGCCGCAGAATGACCGCAGTGCCCGTGGCGCTGTCCCTCACCGCTAGCTTCATGTCAGCCGTCACTGTCCTGGGCACCCCCTCCGAGGTCTACCGTTTTGGGGCCATTTTTAGCATCTTTGCCTTCACCTACTTCTTTGTGGTGGTCATCAGCGCGGAGGTCTTCCTCCCGGTGTTCTACAAACTGGGAATTACCAGCACCTACGAGTATTTAGAACTTCGATTTAACAAATGTGTTCGTCTCTGTGGAACAGTCCTCTTCATTGTTCAAACAATTCTGTATACTGGAATTGTTATTTATGCCCCTGCCCTGGCTTTGAATCAAGTCACAGGATTTGATCTGTGGGGCGCGGTAGTGGCAACGGGGGTGGTCTGCACATTCTACTGCACACTGGGTGGTCTTAAAGCAGTTATCTGGACAGATGTTTTTCAAGTTGGGATCATGGTGGCTGGATTTGCATCCGTGATTATACAGGCTGTGGTGATGCAAGGTGGAATCAGCACTATTTTAAATGATGCCTATGATGGTGGAAGATTAAATTTCTGGAATTTTAATCCTAACCCTTTGCAAAGACACACCTTCTGGACAATTATTATAGGAGGGACCTTCACATGGACCAGCATCTACGGTGTCAACCAATCCCAGGTGCAGAGATATATTTCTTGTAAAAGCAGATTCCAGGCAAAACTGTCTCTCTACATCAATCTTGTGGGACTCTGGGCAATCCTCACATGCTCAGTGTTTTGTGGGCTCGCCCTATATTCCAGGTACCATGACTGTGATCCTTGGACAGCCAAGAAAGTGTCTGCACCAGACCAGCTCATGCCTTATTTGGTACTGGACATTCTGCAAGATTATCCAGGACTTCCTGGACTTTTTGTGGCCTGTGCTTACAGTGGGACATTAAGCACAGTGTCCTCCAGTATTAATGCCTTAGCAGCAGTAACTGTGGAAGATCTAATCAAACCTTACTTCAGATCGCTCTCAGAAAGGTCTCTGTCTTGGATTTCCCAAGGAATGAGTGTGGTGTATGGAGCCCTGTGTATTGGAATGGCTGCGCTGGCGTCACTTATGGGAGCTTTGTTGCAGGCAGCACTCAGCGTATTTGGTATGGTTGGTGGACCACTTATGGGCCTGTTCGCTTTGGGCATTTTGGTTCCCTTTGCCAACTCAATTGGAGCACTTGTTGGTCTGATGGCTGGATTTGCCATTTCTCTATGGGTTGGAATTGGAGCTCAAATATATCCTCCACTTCCTGAGAGAACATTGCCATTGCACCTTGATATCCAAGGCTGTAACAGCACCTACAATGAGACAAATTTGATGACAACCACAGAAATGCCATTTACTACTAGTGTTTTTCAAATATACAATGTTCAAAGGACTCCACTGATGGATAACTGGTATTCTTTATCATATCTGTACTTCAGCACTGTTGGAACTTTGGTAACATTATTAGTGGGGATACTTGTCAGTTTATCAACAGGAGGAAGAAAACAGAACTTAGACCCCAGATATATACTAACCAAAGAGGACTTTTTATCCAATTTTGATATTTTTAAGAAAAAGAAGCATGTTTTGAGCTATAAATCACATCCAGTGGAAGATGGTGGAACTGATAATCCTGCTTTCAACCACATTGAATTGAACTCAGATCAGAGTGGCAAGAGCAATGGGACTCGTTTGTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTAGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MDTPRGIGTFVVWDYVVFAGMLVISAAIGIYYAFAGGGQQTSKDFLMGGRRMTAVPVALSLTASFMSAVTVLGTPSEVYRFGAIFSIFAFTYFFVVVISAEVFLPVFYKLGITSTYEYLELRFNKCVRLCGTVLFIVQTILYTGIVIYAPALALNQVTGFDLWGAVVATGVVCTFYCTLGGLKAVIWTDVFQVGIMVAGFASVIIQAVVMQGGISTILNDAYDGGRLNFWNFNPNPLQRHTFWTIIIGGTFTWTSIYGVNQSQVQRYISCKSRFQAKLSLYINLVGLWAILTCSVFCGLALYSRYHDCDPWTAKKVSAPDQLMPYLVLDILQDYPGLPGLFVACAYSGTLSTVSSSINALAAVTVEDLIKPYFRSLSERSLSWISQGMSVVYGALCIGMAALASLMGALLQAALSVFGMVGGPLMGLFALGILVPFANSIGALVGLMAGFAISLWVGIGAQIYPPLPERTLPLHLDIQGCNSTYNETNLMTTTEMPFTTSVFQIYNVQRTPLMDNWYSLSYLYFSTVGTLVTLLVGILVSLSTGGRKQNLDPRYILTKEDFLSNFDIFKKKKHVLSYKSHPVEDGGTDNPAFNHIELNSDQSGKSNGTRLLPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGRAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCACCATGGACACGCCACGGGGCATCGGCACCTTCGTGGTGTGGGACTACGTGGTGTTCGCGGGCATGCTGGTCATCTCGGCCGCCATCGGCATCTACTACGCCTTCGCTGGGGGCGGCCAGCAGACCTCCAAGGACTTCCTGATGGGCGGCCGCAGAATGACCGCAGTGCCCGTGGCGCTGTCCCTCACCGCTAGCTTCATGTCAGCCGTCACTGTCCTGGGCACCCCCTCCGAGGTCTACCGTTTTGGGGCCATTTTTAGCATCTTTGCCTTCACCTACTTCTTTGTGGTGGTCATCAGCGCGGAGGTCTTCCTCCCGGTGTTCTACAAACTGGGAATTACCAGCACCTACGAGTATTTAGAACTTCGATTTAACAAATGTGTTCGTCTCTGTGGAACAGTCCTCTTCATTGTTCAAACAATTCTGTATACTGGAATTGTTATTTATGCCCCTGCCCTGGCTTTGAATCAAGTCACAGGATTTGATCTGTGGGGCGCGGTAGTGGCAACGGGGGTGGTCTGCACATTCTACTGCACACTGGGTGGTCTTAAAGCAGTTATCTGGACAGATGTTTTTTCAAGTTGGGATCATGGTGGCTGGATTTGCATCCGTGATTATACAGCTGTGGTGATGCAAGGTGGAATCAGCACTATTTTAAATGATGCCTATGATGGTGGAGATTAAATTTCTGGAATTTAATCCTACCCTTTGCAAGACACACCTTCTGGACAATTATTATAGGAGGGACCTTCACATGGACAGCATCTACGGGTCACCAATCCCAGGTGCATAGATTATATTTCTTGGTAAAGCAGATTCCAGCAAAACTGTTCCTCTTACATCTATCTTGTGGGATCTTGGGCATCCTCACATGCTCATGTTTTTTGGCTCGCCCTTTATATCCAGGTACCATGACTGTGGATCTTGGAACGGCCAAAAAAGTGTCT
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCTCCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.24|C|4 Available