hGUHO04027

DGRC Stock Number: 1662158

RRID: RRID:DGRC_1662158

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO04027

When publishing experiments using hGUHO04027, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO04027 (DGRC Stock 1662158 ; https://dgrc.bio.indiana.edu//stock/1662158 ; RRID:DGRC_1662158)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene CLASP2   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
chb CLASP2 13 No Yes
Base Vector pGW-HA.attB
AA Size 509
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAGGCGACTGATTTGCAAACGGATCTGTGATTATAAAAGCTTCGATGATGAAGAATCAGTGGATGGAAATAGGCCATCATCAGCTGCATCAGCCTTCAAGGTTCCTGCACCTAAAACATCCGGAAATCCTGCCAACAGTGCAAGGAAGCCTGGTTCAGCAGGTGGCCCTAAGGTTGGAGGTGCTTCTAAGGAAGGAGGTGCTGGAGCAGTTGATGAAGATGATTTTATAAAAGCTTTTACAGATGTCCCTTCTATTCAGATTTATTCTAGTCGAGAACTCGAAGAAACATTAAATAAAATCAGGGAAATTTTGTCAGATGATAAACATGACTGGGATCAGCGTGCCAATGCACTGAAGAAAATTCGATCACTGCTTGTTGCTGGAGCTGCACAGTATGATTGCTTTTTTCAACATTTACGATTGTTGGATGGAGCACTTAAACTTTCAGCTAAGGATCTTAGATCCCAGGTGGTTAGAGAAGCTTGTATTACTGTAGCCCACCTTTCAACAGTTTTGGGAAACAAGTTTGATCATGGCGCTGAAGCCATTGTACCTACACTTTTTAATCTCGTCCCCAATAGTGCAAAAGTCATGGCAACTTCTGGATGTGCAGCAATCAGATTTATCATTCGGCATACTCATGTACCCAGACTTATACCTTTAATAACAAGCAATTGCACATCAAAATCAGTTCCCGTGAGGAGACGTTCATTTGAATTTTTAGATTTATTGTTGCAAGAGTGGCAGACTCATTCATTGGAAAGACATGCAGCCGTCTTGGTTGAAACTATTAAAAAGGGAATTCATGATGCTGACGCTGAGGCCAGAGTGGAGGCAAGAAAGACATACATGGGTCTTAGAAACCACTTTCCTGGTGAAGCTGAAACATTATATAATTCCCTTGAGCCATCTTATCAGAAGAGTCTTCAAACTTACTTAAAGAGTTCTGGCAGTGTAGCATCTCTTCCACAATCAGACAGGTCCTCATCCAGCTCACAGGAAAGTCTCAATCGCCCTTTTTCTTCCAAATGGTCTACAGCAAATCCATCAACTGTGGCTGGAAGAGTATCAGCAGGCAGCAGCAAAGCCAGTTCCCTTCCAGGAAGCCTGCAGCGTTCACGAAGTGACATTGATGTGAATGCTGCTGCAGGTGCCAAGGCACATCATGCTGCTGGACAGTCTGTGCGAAGCGGGCGCTTAGGTGCAGGTGCCCTGAATGCAGGTTCCTATGCGTCACTAGAATGTGAAGCCTTTTGGAGATCTGGGAGAACTGCAAAGCTCTACTCTGTCTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MRRLICKRICDYKSFDDEESVDGNRPSSAASAFKVPAPKTSGNPANSARKPGSAGGPKVGGASKEGGAGAVDEDDFIKAFTDVPSIQIYSSRELEETLNKIREILSDDKHDWDQRANALKKIRSLLVAGAAQYDCFFQHLRLLDGALKLSAKDLRSQVVREACITVAHLSTVLGNKFDHGAEAIVPTLFNLVPNSAKVMATSGCAAIRFIIRHTHVPRLIPLITSNCTSKSVPVRRRSFEFLDLLLQEWQTHSLERHAAVLVETIKKGIHDADAEARVEARKTYMGLRNHFPGEAETLYNSLEPSYQKSLQTYLKSSGSVASLPQSDRSSSSSQESLNRPFSSKWSTANPSTVAGRVSAGSSKASSLPGSLQRSRSDIDVNAAAGAKAHHAAGQSVRSGRLGAGALNAGSYASLECEAFWRSGRTAKLYSVYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCATGAGGCGACTGATTTGCAAACGGATCTGTGATTATAAAAGCTTCGATGATGAAGAATCAGTGGATGGAAATAGGCCATCATCAGCTGCATCAGCCTTCAAGGTTCCTGCACCTAAAACATCCGGAAATCCTGCCAACAGTGCAAGGAAGCCTGGTTCAGCAGGTGGCCCTAAGGTTGGAGGTGCTTCTAAGGAAGGAGGTGCTGGAGCAGTTGATGAAGATGATTTTATAAAAGCTTTTACAGATGTCCCTTCTATTCAGATTTATTCTAGTCGAGAACTCGAAGAAACATTAAATAAAATCAGGGAAATTTTGTCAGATGATAAACATGACTGGGATCAGCGTGCCAATGCACTGAAGAAAATTCGATCACTGCTTGTTGCTGGAGCTGCACAGTATGATTGCTTTTTTCAACATTTACGATTGTTGGATGGAGCACTTAAACTTTCAGCTAAGGATCTTAGATCCCAGGTGGTTAGAGAAGCTTGTATTACTGTAGCCCACCTTTCAACAGTTTTGGGAAACAAGTTTGATCATGGCGCTGAAGCCATTGTACCTACACTTTTTAATCTCGTCCCCAATAGTGCAAAAGTCATGGCAACTTCTGGATGTGCAGCAATCAGATTTATCATTCGGCATACTCATGTACCCAGACTTATACCTTTAATAACAAGCAATTGCACATCAAAATCAGTTCCCGTGAGGAGACGTTCATTTGAATTTTTAAATTTATTGTTGCAAGATGCAGCTCATCATGAAGCTGAGCGCTGTGACATAAAGATCTGTGTGCGTGAGCAATGAGAGAGCTATGGTCTAGACATTCTGTGACGACTATATCTACACTACAAGCTCACTACTAGAGTCGCATGACTCTTCAATCGACGTCCACCAGCCAGATCATC
Sequenced 3' End TCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.21|B|2 Available