hGUHO03170

DGRC Stock Number: 1662136

RRID: RRID:DGRC_1662136

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03170

When publishing experiments using hGUHO03170, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03170 (DGRC Stock 1662136 ; https://dgrc.bio.indiana.edu//stock/1662136 ; RRID:DGRC_1662136)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene A4GALT   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
alpha4GT1 A4GALT 14 Yes Yes
alpha4GT2 A4GALT 13 Yes No
Base Vector pGW-HA.attB
AA Size 431
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGTCCAAGCCCCCCGACCTCCTGCTGCGGCTGCTCCGGGGCGCCCCAAGGCAGCGGGTCTGCACCCTGTTCATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGACTTCATTGTTCTCAAGAACCTGCGGAACCTGACCAACGTGCTGGGCACCCAGTCCCGCTACGTCCTCAACGGCGCGTTCCTGGCCTTCGAGCGCCGGCACGAGTTCATGGCGCTGTGCATGCGGGACTTCGTGGACCACTACAACGGCTGGATCTGGGGTCACCAGGGCCCGCAGCTGCTCACGCGGGTCTTCAAGAAGTGGTGTTCCATCCGCAGCCTGGCCGAGAGCCGCGCCTGCCGCGGCGTCACCACCCTGCCCCCTGAGGCCTTCTACCCCATCCCCTGGCAGGACTGGAAGAAGTACTTTGAGGACATCAACCCCGAGGAGCTGCCGCGGCTGCTCAGTGCCACCTATGCTGTCCACGTGTGGAACAAGAAGAGCCAGGGCACGCGGTTCGAGGCCACGTCCAGGGCACTGCTGGCCCAGCTGCATGCCCGCTACTGCCCCACGACGCACGAGGCCATGAAAATGTACTTGTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSKPPDLLLRLLRGAPRQRVCTLFIIGFKFTFFVSIMIYWHVVGEPKEKGQLYNLPAEIPCPTLTPPTPPSHGPTPGNIFFLETSDRTNPNFLFMCSVESAARTHPESHVLVLMKGLPGGNASLPRHLGISLLSCFPNVQMLPLDLRELFRDTPLADWYAAVQGRWEPYLLPVLSDASRIALMWKFGGIYLDTDFIVLKNLRNLTNVLGTQSRYVLNGAFLAFERRHEFMALCMRDFVDHYNGWIWGHQGPQLLTRVFKKWCSIRSLAESRACRGVTTLPPEAFYPIPWQDWKKYFEDINPEELPRLLSATYAVHVWNKKSQGTRFEATSRALLAQLHARYCPTTHEAMKMYLCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|H|4 Available