hGUHO02893

DGRC Stock Number: 1662123

RRID: RRID:DGRC_1662123

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02893

When publishing experiments using hGUHO02893, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02893 (DGRC Stock 1662123 ; https://dgrc.bio.indiana.edu//stock/1662123 ; RRID:DGRC_1662123)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene HEY2   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Hey HEY2 9 Yes Yes
Base Vector pGW-HA.attB
AA Size 415
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAAGCGCCCCTGCGAGGAGACGACCTCCGAGAGCGACATGGACGAGACCATCGACGTGGGGAGCGAGAACAATTACTCGGGGCAAAGTACTAGCTCTGTGATTAGATTGAATTCTCCAACAACAACATCTCAGATTATGGCAAGAAAGAAAAGGAGAGGGATTATAGAGAAAAGGCGTCGGGATCGGATAAATAACAGTTTATCTGAGTTGAGAAGACTTGTGCCAACTGCTTTTGAAAAACAAGGATCTGCAAAGTTAGAAAAAGCTGAAATATTGCAAATGACAGTGGATCATTTGAAGATGCTTCAGGCAACAGGGGGTAAAGGCTACTTTGACGCACACGCTCTTGCCATGGACTTCATGAGCATAGGATTCCGAGAGTGCCTAACAGAAGTTGCGCGGTACCTGAGCTCCGTGGAAGGCCTGGACTCCTCGGATCCGCTGCGGGTGCGGCTTGTGTCTCATCTCAGCACTTGCGCCACCCAGCGGGAGGCGGCGGCCATGACATCCTCCATGGCCCACCACCATCATCCGCTCCACCCGCATCACTGGGCCGCCGCCTTCCACCACCTGCCCGCAGCCCTGCTCCAGCCCAACGGCCTCCATGCCTCAGAGTCAACCCCTTGTCGCCTCTCCACAACTTCAGAAGTGCCTCCTGCCCACGGCTCTGCTCTCCTCACGGCCACGTTTGCCCATGCGGATTCAGCCCTCCGAATGCCATCCACGGGCAGCGTCGCCCCCTGCGTGCCACCTCTCTCCACCTCTCTCTTGTCCCTCTCTGCCACCGTCCACGCCGCAGCCGCAGCAGCCACCGCGGCTGCACACAGCTTCCCTCTGTCCTTCGCGGGGGCATTCCCCATGCTTCCCCCAAACGCAGCAGCAGCAGTGGCCGCGGCCACAGCCATCAGCCCGCCCTTGTCAGTATCAGCCACGTCCAGTCCTCAGCAGACCAGCAGTGGAACAAACAATAAACCTTACCGACCCTGGGGGACAGAAGTTGGAGCTTTTTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MKRPCEETTSESDMDETIDVGSENNYSGQSTSSVIRLNSPTTTSQIMARKKRRGIIEKRRRDRINNSLSELRRLVPTAFEKQGSAKLEKAEILQMTVDHLKMLQATGGKGYFDAHALAMDFMSIGFRECLTEVARYLSSVEGLDSSDPLRVRLVSHLSTCATQREAAAMTSSMAHHHHPLHPHHWAAAFHHLPAALLQPNGLHASESTPCRLSTTSEVPPAHGSALLTATFAHADSALRMPSTGSVAPCVPPLSTSLLSLSATVHAAAAAATAAAHSFPLSFAGAFPMLPPNAAAAVAAATAISPPLSVSATSSPQQTSSGTNNKPYRPWGTEVGAFYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|G|3 Available