hGUHO02869

DGRC Stock Number: 1662111

RRID: RRID:DGRC_1662111

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02869

When publishing experiments using hGUHO02869, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02869 (DGRC Stock 1662111 ; https://dgrc.bio.indiana.edu//stock/1662111 ; RRID:DGRC_1662111)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PELI3   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Pli PELI3 13 No Yes
Base Vector pGW-HA.attB
AA Size 409
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGTGCTGGAAGGAAACCCTGAAGTGGGGTCCCCCCGAACCTCAGACCTCCAGCACCGGGGGAACAAGGGCTCTTGCGTTCTCTCCTCTCCCGGTGAAGATGCGCAGCCAGGCGAGGAGCCCATCAAGTATGGTGAACTCATCGTCCTGGGATGCTGTGAGGAAGGAGGTGAGGAAACCGAGGCTCAGAGAGGGGAAGTGACTGGCCCAAGGGCACACAGCTGCTACAATGGTTGTCTGGCAAGTGGGGACAAGGGCCGCCGGCGAAGCCGCCTGGCACTGAGCCGCCGGTCGCACGCCAACGGGGTGAAGCCAGACGTCATGCACCACATCTCCACGCCGCTCGTCTCCAAGGCACTGAGTAACCGTGGTCAGCACAGCATCTCGTATACACTGTCCCGGAGCCACTCGGTCATAGTGGAGTATACACATGATAGCGACACAGACATGTTCCAGATTGGCCGCTCCACAGAGAACATGATTGACTTCGTGGTAACAGACACGTCCCCTGGAGGAGGGGCTGCCGAGGGCCCTTCTGCCCAGAGCACCATCTCCCGCTATGCCTGCCGCATCCTCTGTGACCGCCGGCCACCCTATACTGCCCGCATCTATGCCGCTGGCTTCGACGCCTCTAGCAACATCTTCCTTGGAGAGCGAGCGGCCAAATGGCGGACCCCAGATGGCCTGATGGATGGACTGACCACCAATGGAGTCCTGGTGATGCACCCGGCAGGCGGCTTCTCCGAGGACTCAGCCCCGGGTGTCTGGCGGGAGATCTCGGTCTGTGGGAATGTGTACACATTGCGGGACAGCCGCTCAGCCCAGCAGCGGGGCAAGCTGGTAGGTGGCCCGCTCCATTCCCCACCCCTATCCTTGCCAGGCCCTCACAAGCTGCCCATCCCCCTGCCCAAGCCAGGAGATGATCTCCAGTCCTTCTGCCCCAGGGAGCCCCAACAGGCTCCATATCAGGGAATCCCAGGCCCAGGGGGTTCTTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MVLEGNPEVGSPRTSDLQHRGNKGSCVLSSPGEDAQPGEEPIKYGELIVLGCCEEGGEETEAQRGEVTGPRAHSCYNGCLASGDKGRRRSRLALSRRSHANGVKPDVMHHISTPLVSKALSNRGQHSISYTLSRSHSVIVEYTHDSDTDMFQIGRSTENMIDFVVTDTSPGGGAAEGPSAQSTISRYACRILCDRRPPYTARIYAAGFDASSNIFLGERAAKWRTPDGLMDGLTTNGVLVMHPAGGFSEDSAPGVWREISVCGNVYTLRDSRSAQQRGKLVGGPLHSPPLSLPGPHKLPIPLPKPGDDLQSFCPREPQQAPYQGIPGPGGSYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|F|3 Available