hGUHO02231

DGRC Stock Number: 1662077

RRID: RRID:DGRC_1662077

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02231

When publishing experiments using hGUHO02231, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02231 (DGRC Stock 1662077 ; https://dgrc.bio.indiana.edu//stock/1662077 ; RRID:DGRC_1662077)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene TLE5   ( Entrez , HGNC )
Base Vector pGW-HA.attB
AA Size 342
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGTGTCACAAGAATGGCTTCCCTCAGGAAGGCGGCATTACCGCTGCCTTTCTGCAGAAAAGGAAACTAAGGCTCAGCAAGAACCACCGCCCAGCCAGAGCCAAGGTCACAGAGCACGTCCGTGGCACGCGTCCAGGTCGTGCCACAGCAGGGCCGGCGGCTTCGACGCGGGCAGCCGGGTCCCTTTTCTTTGACAGATGGGGAAACCGAGGCCCGGCCGGCTGCCGGGGCTCCTCGCACCTACCCCAGCAACTCAAATTCACCACCTCGGACTCCTGCGACCGCATCAAAGACGAATTTCAGCTACTGCAAGCTCAGTACCACAGCCTCAAGCTCGAATGTGACAAGTTGGCCAGTGAGAAGTCAGAGATGCAGCGTCACTATGTGATGTACTACGAGATGTCCTACGGCTTGAACATCGAGATGCACAAACAGGCTGAGATCGTCAAAAGGCTGAACGGGATTTGTGCCCAGGTCCTGCCCTACCTCTCCCAAGAGCACCAGCAGCAGGTCTTGGGAGCCATTGAGAGGGCCAAGCAGGTCACCGCTCCCGAGCTGAACTCTATCATCCGACAGCAGCTCCAAGCCCACCAGCTGTCCCAGCTGCAGGCCCTGGCCCTGCCCTTGACCCCACTACCCGTGGGGCTGCAGCCGCCTTCGCTGCCGGCGGTCAGCGCAGGCACCGGCCTCCTCTCGCTGTCCGCGCTGGGTTCCCAGGCCCACCTCTCCAAGGAAGACAAGAACGGGCACGATGGTGACACCCACCAGGAGGATGATGGCGAGAAGTCGGATTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MCHKNGFPQEGGITAAFLQKRKLRLSKNHRPARAKVTEHVRGTRPGRATAGPAASTRAAGSLFFDRWGNRGPAGCRGSSHLPQQLKFTTSDSCDRIKDEFQLLQAQYHSLKLECDKLASEKSEMQRHYVMYYEMSYGLNIEMHKQAEIVKRLNGICAQVLPYLSQEHQQQVLGAIERAKQVTAPELNSIIRQQLQAHQLSQLQALALPLTPLPVGLQPPSLPAVSAGTGLLSLSALGSQAHLSKEDKNGHDGDTHQEDDGEKSDLPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End CAACTACTGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGAGAACTCTGAATAGGGAATTGGGAATTCGTTAACAGATCTCGAAGTTCCTATTCTTCAAAAGGTATAGGAACTTCAACCGGTACAAGTTTGTACAAAAAAGTTGGCACCATGTGTCACAAGAATGGCTTCCCTCAGGAAGGCGGCATTACCGCTGCCTTTCTGCAGAAAAGGAAACTAAGGCTCAGCAAGAACCACCGCCCAGCCAGAGCCAAGGTCACAGAGCACGTCCGTGGCACGCGTCCAGGTCGTGCCACAGCAGGGCCGGGGGCTTCGACGCGGGCAGCCGGGGTCCCTTTTCTTTGACAGATGGGGAAACCGAGGCCCGGCCGGCTGCCGGGGCTCCTTCGCACCTACCCCAGCAACTCAAATTTCACCACCTCGGACTTCTTGGGAACCGCATCAAAAGAACGAAATTTCAGCTTACTGCAAGCTTCATTACCAAAGGCCTTCAAGCTTCGAATGTGGAAAAGGTTGGCCCAGTTAAGAAGTCTC
Sequenced 3' End GTTACCCCGCCCACCAATGACGCTCCCATCGAGCGTTGAAGTGGCGCGACGCTTAGTGCTAGCGTCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAAATTAACCCCGCAGGTCCACCGGCTCCACCAGCGCCAGCAGTAGCACCGCCTCCTGAAGGAGCTCCAAGGATGGAAGTTCCTATACTAAGTAGAGAATAGGAACTTCGAGGTACCACCACTTTGTACAAGAAAGTTGGCAAATCCGACTTCTCGCCATCATCCTCCTGGTGGGTGTCACCATCGTGCCCGTTCTTGTCTTCCTTGGAGAGGTGGGCCTGGGAACCCAGCGCGGACAGCGAGAGGAGGCCGGTGCCTGCGCTGACCGCCGGCAGCGAAGGCGGCTGCAGCCCCACGGTAGTGGGGTCAAAGGCAGGGCCAGGGCCCTGCAGCTGGGACAGCTGGTGGGCTTGGAGCTGCTGTCGGATGATAGAGTTCAGCTCGGGGAGCGGTGAACT
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|C|5 Available