hGUHO03604

DGRC Stock Number: 1662072

RRID: RRID:DGRC_1662072

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03604

When publishing experiments using hGUHO03604, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03604 (DGRC Stock 1662072 ; https://dgrc.bio.indiana.edu//stock/1662072 ; RRID:DGRC_1662072)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PRKAR1A   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Pka-R1 PRKAR1A 14 Yes Yes
Base Vector pGW-HA.attB
AA Size 459
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGAGTCTGGCAGTACCGCCGCCAGTGAGGAGGCACGCAGCCTTCGAGAATGTGAGCTCTACGTCCAGAAGCATAACATTCAAGCGCTGCTCAAAGATTCTATTGTGCAGTTGTGCACTGCTCGACCTGAGAGACCCATGGCATTCCTCAGGGAATACTTTGAGAGGTTGGAGAAGGAGGAGGCAAAACAGATTCAGAATCTGCAGAAAGCAGGCACTCGTACAGACTCAAGGGAGGATGAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGGTAGGAGGCGACGAGGTGCTATCAGCGCTGAGGTCTACACGGAGGAAGATGCGGCATCCTATGTTAGAAAGGTTATACCAAAAGATTACAAGACAATGGCCGCTTTAGCCAAAGCCATTGAAAAGAATGTGCTGTTTTCACATCTTGATGATAATGAGAGAAGTGATATTTTTGATGCCATGTTTTCGGTCTCCTTTATCGCAGGAGAGACTGTGATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGAGAGACGGATGTCTATGTTAACAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTTGGAGAACTTGCTTTGATTTATGGAACACCGAGAGCAGCCACTGTCAAAGCAAAGACAAATGTGAAATTGTGGGGCATCGACCGAGACAGCTATAGAAGAATCCTCATGGGAAGCACACTGAGAAAGCGGAAGATGTATGAGGAATTCCTTAGTAAAGTCTCTATTTTAGAGTCTCTGGACAAGTGGGAACGTCTTACGGTAGCTGATGCATTGGAACCAGTGCAGTTTGAAGATGGGCAGAAGATTGTGGTGCAGGGAGAACCAGGGGATGAGTTCTTCATTATTTTAGAGGGGTCAGCTGCTGTGCTACAACGTCGGTCAGAAAATGAAGAGTTTGTTGAAGTGGGAAGATTGGGGCCTTCTGATTATTTTGGTGAAATTGCACTACTGATGAATCGTCCTCGTGCTGCCACAGTTGTTGCTCGTGGCCCCTTGAAGTGCGTTAAGCTGGACCGACCTAGATTTGAACGTGTTCTTGGCCCATGCTCAGACATCCTCAAACGAAACATCCAGCAGTACAACAGTTTTGTGTCACTGTCTGTCTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MESGSTAASEEARSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKAGTRTDSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFSVSFIAGETVIQQGDEGDNFYVIDQGETDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGIDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSVCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|B|12 Available