hGUHO03640

DGRC Stock Number: 1662066

RRID: RRID:DGRC_1662066

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03640

When publishing experiments using hGUHO03640, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03640 (DGRC Stock 1662066 ; https://dgrc.bio.indiana.edu//stock/1662066 ; RRID:DGRC_1662066)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PDHA1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
l(1)G0334 PDHA1 14 No Yes
CG7024 PDHA1 10 Yes No
Base Vector pGW-HA.attB
AA Size 468
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCTTCTCAGAAGCCGGCAAGCAGAGTGCTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATTAAGAAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACTTGTGTGATGGTCAGGAAGCTTGCTGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAGGACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCAGGTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAACCAGGGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGTGGAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGAACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGATTTCATTCCTGGGCTGAGAGTGGATGGAATGGATATCCTGTGCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAGGGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGGACACAGTATGAGTGACCCTGGAGTCAGTTACCGTACACGAGAAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAAGTTTAAGTCAGTCAGTTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MRKMLAAVSRVLSGASQKPASRVLVASRNFANDATFEIKKCDLHRLEEGPPVTTVLTREDGLKYYRMMQTVRRMELKADQLYKQKIIRGFCHLCDGQEACCVGLEAGINPTDHLITAYRAHGFTFTRGLSVREILAELTGRKGGCAKGKGGSMHMYAKNFYGGNGIVGAQVPLGAGIALACKYNGKDEVCLTLYGDGAANQGQIFEAYNMAALWKLPCIFICENNRYGMGTSVERAAASTDYYKRGDFIPGLRVDGMDILCVREATRFAAAYCRSGKGPILMELQTYRYHGHSMSDPGVSYRTREEIQEVRSKSDPIMLLKDRMVNSNLASVEELKEIDVEVRKEIEDAAQFATADPEPPLEELGYHIYSSDPPFEVRGANQWIKFKSVSYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|B|6 Available