hGUHO03893

DGRC Stock Number: 1662057

RRID: RRID:DGRC_1662057

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03893

When publishing experiments using hGUHO03893, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03893 (DGRC Stock 1662057 ; https://dgrc.bio.indiana.edu//stock/1662057 ; RRID:DGRC_1662057)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PACSIN3   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Synd PACSIN3 11 No Yes
Base Vector pGW-HA.attB
AA Size 502
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGCTCCAGAAGAGGACGCTGGAGGGGAGGCCTTAGGGGGCAGTTTCTGGGAGGCTGGCAACTACAGGCGCACGGTACAGCGGGTGGAGGACGGGCACCGGCTGTGCGGGGACCTGGTCAGCTGCTTCCAGGAGCGCGCCCGCATCGAGAAGGCTTATGCCCAGCAGTTGGCTGACTGGGCCCGAAAGTGGAGGGGGACCGTGGAGAAGGGCCCCCAGTATGGCACACTGGAGAAGGCCTGGCATGCCTTTTTCACGGCGGCTGAGCGGCTGAGCGCGCTGCACCTGGAGGTGCGGGAGAAGCTGCAAGGGCAGGACAGTGAGCGGGTGCGCGCCTGGCAGCGGGGGGCTTTCCACCGGCCTGTGCTGGGCGGCTTCCGCGAGAGCCGGGCGGCCGAGGACGGCTTCCGCAAGGCCCAGAAGCCCTGGCTGAAGAGGCTGAAGGAGGTTGAGGCTTCCAAGAAAAGCTACCACGCAGCCCGGAAGGATGAGAAGACCGCCCAGACGAGGGAGAGCCACGCAAAGGCAGACAGCGCCGTCTCCCAGGAGCAGCTGCGCAAACTGCAGGAACGGGTGGAACGCTGTGCCAAGGAGGCCGAGAAGACAAAAGCTCAGTATGAGCAGACGCTGGCAGAGCTGCATCGCTACACTCCACGCTACATGGAGGACATGGAACAGGCCTTTGAGACCTGCCAGGCCGCCGAGCGCCAGCGGCTTCTTTTCTTCAAGGATATGCTGCTCACCTTACACCAGCACCTGGACCTTTCCAGCAGTGAGAAGTTCCATGAACTCCACCGTGACTTGCACCAGGGCATTGAGGCAGCCAGTGACGAAGAGGATCTGCGCTGGTGGCGCAGCACCCACGGGCCAGGCATGGCCATGAACTGGCCACAGTTCGAGGAGTGGTCCTTGGACACACAGAGGACAATCAGCCGGAAAGAGAAGGGTGGCCGGAGCCCTGATGAGGTTACCCTGACCAGCATTGTGCCTACAAGAGATGGCACCGCACCCCCACCCCAGTCCCCGGGGTCCCCAGGCACGGGGCAGGATGAGGAGTGGTCAGATGAAGAGAGTCCCCGGAAGGCTGCCACCGGGGTTCGGGTGAGGGCACTCTATGACTACGCTGGCCAGGAAGCTGATGAGCTGAGCTTCCGAGCAGGGGAGGAGCTGCTGAAGATGAGTGAGGAGGACGAGCAGGGCTGGTGCCAAGGCCAGTTGCAGAGTGGCCGCATTGGCCTGTACCCTGCCAACTACGTGGAGTGTGTGGGCGCCTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MAPEEDAGGEALGGSFWEAGNYRRTVQRVEDGHRLCGDLVSCFQERARIEKAYAQQLADWARKWRGTVEKGPQYGTLEKAWHAFFTAAERLSALHLEVREKLQGQDSERVRAWQRGAFHRPVLGGFRESRAAEDGFRKAQKPWLKRLKEVEASKKSYHAARKDEKTAQTRESHAKADSAVSQEQLRKLQERVERCAKEAEKTKAQYEQTLAELHRYTPRYMEDMEQAFETCQAAERQRLLFFKDMLLTLHQHLDLSSSEKFHELHRDLHQGIEAASDEEDLRWWRSTHGPGMAMNWPQFEEWSLDTQRTISRKEKGGRSPDEVTLTSIVPTRDGTAPPPQSPGSPGTGQDEEWSDEESPRKAATGVRVRALYDYAGQEADELSFRAGEELLKMSEEDEQGWCQGQLQSGRIGLYPANYVECVGACPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.20|A|9 Available