hGUHO03862

DGRC Stock Number: 1661945

RRID: RRID:DGRC_1661945

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03862

When publishing experiments using hGUHO03862, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03862 (DGRC Stock 1661945 ; https://dgrc.bio.indiana.edu//stock/1661945 ; RRID:DGRC_1661945)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PGK1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Pgk PGK1 14 Yes Yes
CG9961 PGK1 7 Yes No
Base Vector pGW-HA.attB
AA Size 495
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGTCGCTTTCTAACAAGCTGACGCTGGACAAGCTGGACGTTAAAGGGAAGCGGGTCGTTATGAGAGTCGACTTCAATGTTCCTATGAAGAACAACCAGATAACAAACAACCAGAGGATTAAGGCTGCTGTCCCAAGCATCAAATTCTGCTTGGACAATGGAGCCAAGTCGGTAGTCCTTATGAGCCACCTAGGCCGGCCTGATGGTGTGCCCATGCCTGACAAGTACTCCTTAGAGCCAGTTGCTGTAGAACTCAAATCTCTGCTGGGCAAGGATGTTCTGTTCTTGAAGGACTGTGTAGGCCCAGAAGTGGAGAAAGCCTGTGCCAACCCAGCTGCTGGGTCTGTCATCCTGCTGGAGAACCTCCGCTTTCATGTGGAGGAAGAAGGGAAGGGAAAAGATGCTTCTGGGAACAAGGTTAAAGCCGAGCCAGCCAAAATAGAAGCTTTCCGAGCTTCACTTTCCAAGCTAGGGGATGTCTATGTCAATGATGCTTTTGGCACTGCTCACAGAGCCCACAGCTCCATGGTAGGAGTCAATCTGCCACAGAAGGCTGGTGGGTTTTTGATGAAGAAGGAGCTGAACTACTTTGCAAAGGCCTTGGAGAGCCCAGAGCGACCCTTCCTGGCCATCCTGGGCGGAGCTAAAGTTGCAGACAAGATCCAGCTCATCAATAATATGCTGGACAAAGTCAATGAGATGATTATTGGTGGTGGAATGGCTTTTACCTTCCTTAAGGTGCTCAACAACATGGAGATTGGCACTTCTCTGTTTGATGAAGAGGGAGCCAAGATTGTCAAAGACCTAATGTCCAAAGCTGAGAAGAATGGTGTGAAGATTACCTTGCCTGTTGACTTTGTCACTGCTGACAAGTTTGATGAGAATGCCAAGACTGGCCAAGCCACTGTGGCTTCTGGCATACCTGCTGGCTGGATGGGCTTGGACTGTGGTCCTGAAAGCAGCAAGAAGTATGCTGAGGCTGTCACTCGGGCTAAGCAGATTGTGTGGAATGGTCCTGTGGGGGTATTTGAATGGGAAGCTTTTGCCCGGGGAACCAAAGCTCTCATGGATGAGGTGGTGAAAGCCACTTCTAGGGGCTGCATCACCATCATAGGTGGTGGAGACACTGCCACTTGCTGTGCCAAATGGAACACGGAGGATAAAGTCAGCCATGTGAGCACTGGGGGTGGTGCCAGTTTGGAGCTCCTGGAAGGTAAAGTCCTTCCTGGGGTGGATGCTCTCAGCAATATTTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSLSNKLTLDKLDVKGKRVVMRVDFNVPMKNNQITNNQRIKAAVPSIKFCLDNGAKSVVLMSHLGRPDGVPMPDKYSLEPVAVELKSLLGKDVLFLKDCVGPEVEKACANPAAGSVILLENLRFHVEEEGKGKDASGNKVKAEPAKIEAFRASLSKLGDVYVNDAFGTAHRAHSSMVGVNLPQKAGGFLMKKELNYFAKALESPERPFLAILGGAKVADKIQLINNMLDKVNEMIIGGGMAFTFLKVLNNMEIGTSLFDEEGAKIVKDLMSKAEKNGVKITLPVDFVTADKFDENAKTGQATVASGIPAGWMGLDCGPESSKKYAEAVTRAKQIVWNGPVGVFEWEAFARGTKALMDEVVKATSRGCITIIGGGDTATCCAKWNTEDKVSHVSTGGGASLELLEGKVLPGVDALSNILPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.18|H|5 Available