hGUHO03273

DGRC Stock Number: 1661874

RRID: RRID:DGRC_1661874

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03273

When publishing experiments using hGUHO03273, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03273 (DGRC Stock 1661874 ; https://dgrc.bio.indiana.edu//stock/1661874 ; RRID:DGRC_1661874)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene DNAJB12   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG3061 DNAJB12 14 Yes Yes
CG30156 DNAJB12 7 Yes No
Base Vector pGW-HA.attB
AA Size 453
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGAATCCAACAAGGATGAAGCTGAGCGCTGTATCAGCATCGCCCTCAAGGCCATCCAGAGCAACCAGCCCGACCGGGCGCTCCGCTTCCTGGAGAAGGCACAGCGGCTGTATCCGACGCCGCGAGTTCGCGCCCTGATTGAGTCCCTCAACCAGAAACCACAGACTGCCGGTGACCAACCCCCACCCACAGACACAACCCATGCCACCCACAGGAAAGCAGGTGGGACCGATGCCCCCTCGGCCAACGGTGAAGCTGGAGGAGAGAGCACCAAAGGCTACACTGCAGAACAGGTTGCAGCTGTGAAAAGGGTCAAGCAATGTAAAGATTACTATGAGATCCTGGGGGTGAGCAGAGGGGCCTCGGATGAGGACCTGAAGAAGGCCTACCGCAGACTGGCCCTCAAATTCCACCCAGACAAGAACCACGCACCTGGTGCCACTGAAGCCTTCAAAGCCATTGGCACAGCATATGCGGTACTCAGCAACCCGGAGAAGAGGAAGCAGTATGACCAGTTCGGCGATGACAAGAGCCAGGCGGCCCGGCACGGCCATGGGCATGGGGATTTCCACCGTGGCTTTGAGGCCGACATCTCCCCTGAAGACCTCTTCAACATGTTCTTTGGCGGCGGCTTCCCTTCTAGTAACGTCCACGTCTACAGCAACGGCCGCATGCGCTATACCTACCAGCAAAGGCAGGACCGCAGGGACAACCAGGGTGATGGCGGGCTAGGGGTGTTTGTGCAGCTGATGCCTATCCTCATCCTGATTCTCGTGTCAGCTCTCAGCCAGCTCATGGTCTCCAGTCCACCCTACAGTCTGAGTCCAAGACCGTCCGTGGGCCACATCCACAGGCGAGTCACTGACCACCTGGGTGTCGTCTACTATGTGGGAGACACTTTCTCCGAAGAGTACACAGGCTCCAGCCTCAAAACAGTCGAGCGGAATGTGGAAGATGATTATATCGCCAACCTCCGGAACAACTGCTGGAAGGAGAAGCAGCAGAAGGAAGGCTTGCTGTACCGGGCACGCTACTTTGGCGACACAGATATGTACCACAGAGCACAGAAGATGGGCACCCCCAGCTGCAGCCGACTGTCAGAGGTGCAGGCCTCCCTGCATGGATACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MESNKDEAERCISIALKAIQSNQPDRALRFLEKAQRLYPTPRVRALIESLNQKPQTAGDQPPPTDTTHATHRKAGGTDAPSANGEAGGESTKGYTAEQVAAVKRVKQCKDYYEILGVSRGASDEDLKKAYRRLALKFHPDKNHAPGATEAFKAIGTAYAVLSNPEKRKQYDQFGDDKSQAARHGHGHGDFHRGFEADISPEDLFNMFFGGGFPSSNVHVYSNGRMRYTYQQRQDRRDNQGDGGLGVFVQLMPILILILVSALSQLMVSSPPYSLSPRPSVGHIHRRVTDHLGVVYYVGDTFSEEYTGSSLKTVERNVEDDYIANLRNNCWKEKQQKEGLLYRARYFGDTDMYHRAQKMGTPSCSRLSEVQASLHGYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.18|B|6 Available