hGUHO03093

DGRC Stock Number: 1661841

RRID: RRID:DGRC_1661841

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03093

When publishing experiments using hGUHO03093, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03093 (DGRC Stock 1661841 ; https://dgrc.bio.indiana.edu//stock/1661841 ; RRID:DGRC_1661841)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene GNA11   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
Galphaq GNA11 11 No Yes
CG30054 GNA11 7 Yes No
Base Vector pGW-HA.attB
AA Size 437
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGACTCTGGAGTCCATGATGGCGTGTTGCCTGAGCGATGAGGTGAAGGAGTCCAAGCGGATCAACGCCGAGATCGAGAAGCAGCTGCGGCGGGACAAGCGCGACGCCCGGCGCGAGCTCAAGCTGCTGCTGCTCGGCACGGGCGAGAGCGGGAAGAGCACGTTCATCAAGCAGATGCGCATCATCCACGGCGCCGGCTACTCGGAGGAGGACAAGCGCGGCTTCACCAAGCTCGTCTACCAGAACATCTTCACCGCCATGCAGGCCATGATCCGGGCCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAGTACTACCTGACCGACGTTGACCGCATCGCCACCTTGGGCTACCTGCCCACCCAGCAGGACGTGCTGCGGGTCCGCGTGCCCACCACCGGCATCATCGAGTACCCTTTCGACCTGGAGAACATCATCTTCCGGATGGTGGATGTGGGGGGCCAGCGGTCGGAGCGGAGGAAGTGGATCCACTGCTTTGAGAACGTGACATCCATCATGTTTCTCGTCGCCCTCAGCGAATACGACCAAGTCCTGGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGGACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCCTCTTCCTCAACAAGAAGGACCTGCTGGAGGACAAGATCCTGTACTCGCACCTGGTGGACTACTTCCCCGAGTTCGATGGTCCCCAGCGGGACGCCCAGGCGGCGCGGGAGTTCATCCTGAAGATGTTCGTGGACCTGAACCCCGACAGCGACAAGATCATCTACTCACACTTCACGTGTGCCACCGACACGGAGAACATCCGCTTCGTGTTCGCGGCCGTGAAGGACACCATCCTGCAGCTCAACCTCAAGGAGTACAACCTGGTCTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MTLESMMACCLSDEVKESKRINAEIEKQLRRDKRDARRELKLLLLGTGESGKSTFIKQMRIIHGAGYSEEDKRGFTKLVYQNIFTAMQAMIRAMETLKILYKYEQNKANALLIREVDVEKVTTFEHQYVSAIKTLWEDPGIQECYDRRREYQLSDSAKYYLTDVDRIATLGYLPTQQDVLRVRVPTTGIIEYPFDLENIIFRMVDVGGQRSERRKWIHCFENVTSIMFLVALSEYDQVLVESDNENRMEESKALFRTIITYPWFQNSSVILFLNKKDLLEDKILYSHLVDYFPEFDGPQRDAQAAREFILKMFVDLNPDSDKIIYSHFTCATDTENIRFVFAAVKDTILQLNLKEYNLVLPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCACCATGACTCTGGAGTCCATGATGGCGTGTTGCCTGAGCGATGAGGTGAAGGAGTCCAAGCGGATCAACGCCGAGATCGAGAAGCAGCTGCGGCGGGACAAGCGCGACGCCCGGCGCGAGCTCAAGCTGCTGCTGCTCGGCACGGGCGAGAGCGGGAAGAGCACGTTCATCAAGCAGATGCGCATCATCCACGGCGCCGGCTACTCGGAGGAGGACAAGCGCGGCTTCACCAAGCTCGTCTACCAGAACATCTTCACCGCCATGCAGGCCATGATCCGGGCCATGGAGACGCTCAAGATCCTCTACAAGTACGAGCAGAACAAGGCCAATGCGCTCCTGATCCGGGAGGTGGACGTGGAGAAGGTGACCACCTTCGAGCATCAGTACGTCAGTGCCATCAAGACCCTGTGGGAGGACCCGGGCATCCAGGAATGCTACGACCGCAGGCGCGAGTACCAGCTCTCCGACTCTGCCAAGTACTACCTGACCGACGTTGACCGCATCGCCACCTTGGGCTACCTGCCCACCCAGCAGGACGTGCTGCGGGTCCGCGTGCCCACCACCGGCATCATCGAGTACCCTTTCGACCTGAGAACATCATCTTCCGGATGGTGGATGTGGGGGGCCAGCGGTCGGAGCGGAGGAAGTGGATCCACTGCTTTGAGAACGTGACATCCATCATGTTTCTCGTCGCTCTCAGCGAATACGACCAAGTCCTGTGGAGTCGGACAACGAGAACCGGATGGAGGAGAGCAAAGCCCTGTTCCGGACCATCATCACCTACCCCTGGTTCCAGAACTCCTCCGTCATCTCTTCCTCACAGAAAGGACCTGCTGGAGGACAAGATCCTGTACTCGGCACCTGGTGGACTACTTTCCCCGAGTCGATGGTTCCCAGCGGGACGCTCAGGCGGGCGCGGGGAGTTCATCCTGAAGAATGTTTCGGGGACCTGAAACCCCGGACAGGCGACAAGATCATCGA
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.17|G|9 Available