hGUHO03054

DGRC Stock Number: 1661819

RRID: RRID:DGRC_1661819

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03054

When publishing experiments using hGUHO03054, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03054 (DGRC Stock 1661819 ; https://dgrc.bio.indiana.edu//stock/1661819 ; RRID:DGRC_1661819)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene GPD1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG3215 GPD1 7 Yes No
CG43343 GPD1 6 Yes No
Gpdh GPD1 14 Yes Yes
Base Vector pGW-HA.attB
AA Size 427
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTGCCCAACTTACTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MASKKVCIVGSGNWGSAIAKIVGGNAAQLAQFDPRVTMWVFEEDIGGKKLTEIINTQHENVKYLPGHKLPPNVVAVPDVVQAAEDADILIFVVPHQFIGKICDQLKGHLKANATGISLIKGVDEGPNGLKLISEVIGERLGIPMSVLMGANIASEVADEKFCETTIGCKDPAQGQLLKELMQTPNFRITVVQEVDTVEICGALKNVVAVGAGFCDGLGFGDNTKAAVIRLGLMEMIAFAKLFCSGPVSSATFLESCGVADLITTCYGGRNRKVAEAFARTGKSIEQLEKELLNGQKLQGPETARELYSILQHKGLVDKFPLFMAVYKVCYEGQPVGEFIHCLQNHPEHMCPTYLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGCGGAACCGGAAAGTGGCTGAGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTGCTGAATGGGCAGAAACTGCAGGGGCCGAGACAGCCCGGGAGCTATACAGCATCTTCCAGCACAGGCCTGGTAGACCAGTTTCCCTGTCATGGCTTGTGTACAAGGTTGGTTACAAGGCCAGCCAATGGGTGAATTAATCCACTGGCCTGGCGAATCCTCCCAAAACATTTGTGCCCACCTTACTTTGGTACAA
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.17|E|11 Available