hGUHO03035

DGRC Stock Number: 1661806

RRID: RRID:DGRC_1661806

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03035

When publishing experiments using hGUHO03035, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03035 (DGRC Stock 1661806 ; https://dgrc.bio.indiana.edu//stock/1661806 ; RRID:DGRC_1661806)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene CCNG2   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CycG CCNG2 8 No Yes
Base Vector pGW-HA.attB
AA Size 422
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGAAGGATTTGGGGGCAGAGCACTTGGCAGGTCATGAAGGGGTCCAACTTCTCGGGTTGTTGAACGTCTACCTGGAACAAGAAGAGAGATTCCAACCTCGAGAAAAAGGGCTGAGTTTGATTGAGGCTACCCCGGAGAATGATAACACTTTGTGTCCAGGATTGAGAAATGCCAAAGTTGAAGATTTAAGGAGTTTAGCCAACTTTTTTGGATCTTGCACTGAAACTTTTGTCCTGGCTGTCAATATTTTGGACAGGTTCTTGGCTCTTATGAAGGTGAAACCTAAACATTTGTCTTGCATTGGAGTCTGTTCTTTTTTGCTGGCTGCTAGAATAGTTGAAGAAGACTGCAATATTCCATCCACTCATGATGTGATCCGGATTAGTCAGTGTAAATGTACTGCTTCTGACATAAAACGGATGGAAAAAATAATTTCAGAAAAATTGCACTATGAATTGGAAGCTACTACTGCCTTAAACTTTTTGCACTTATACCATACTATTATACTTTGTCATACTTCAGAAAGGAAAGAAATACTGAGCCTTGATAAACTAGAAGCTCAGCTGAAAGCTTGCAACTGCCGACTCATCTTTTCAAAAGCAAAACCATCTGTATTAGCCTTGTGCCTTCTCAATTTGGAAGTGGAAACTTTGAAATCTGTTGAATTACTGGAAATTCTCTTGCTAGTTAAAAAACATTCCAAGATTAATGACACTGAGTTCTTCTACTGGAGAGAGTTGGTTTCTAAATGCCTAGCCGAGTATTCTTCTCCTGAATGTTGCAAACCAGATCTTAAGAAGTTGGTTTGGATCGTTTCAAGGCGCACAGCCCAGAACCTCCACAACAGCTACTATAGTGTTCCTGAGCTGCCAACGATACCTGAGGGGGGTTGTTTTGATGAAAGTGAAAGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCCCGATCTCAGCTCATTCCAACCTCCACCTACCAGGTTCAAGCGATTCTCATGCCTCAGCCTCCGGAGTAGCTGGGATTACAGCTCCTGGACCTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MKDLGAEHLAGHEGVQLLGLLNVYLEQEERFQPREKGLSLIEATPENDNTLCPGLRNAKVEDLRSLANFFGSCTETFVLAVNILDRFLALMKVKPKHLSCIGVCSFLLAARIVEEDCNIPSTHDVIRISQCKCTASDIKRMEKIISEKLHYELEATTALNFLHLYHTIILCHTSERKEILSLDKLEAQLKACNCRLIFSKAKPSVLALCLLNLEVETLKSVELLEILLLVKKHSKINDTEFFYWRELVSKCLAEYSSPECCKPDLKKLVWIVSRRTAQNLHNSYYSVPELPTIPEGGCFDESESSVAQAGVQWPDLSSFQPPPTRFKRFSCLSLRSSWDYSSWTCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCATGAAGGATTTGGGGGCAGAGCACTTGGCAGGTCATGAAGGGGTCCAACTTCTCGGGTTGTTGAACGTCTACCTGGAACAAGAAGAGAGATTCCAACCTCGAGAAAAAGGGCTGAGTTTGATTGAGGCTACCCCGGAGAATGATAACACTTTGTGTCCAGGATTGAGAAATGCCAAAGTTGAAGATTTAAGGAGTTTAGCCAACTTTTTTGGATCTTGCACTGAAACTTTTGTCCTGGCTGTCAATATTTTGGACAGGTTCTTGGCTCTTATGAAGGTGAAACCTAAACATTTGTCTTGCATTGGAGTCTGTTCTTTTTTGCTGGCTGCTAGAATAGTTGAAGAAGACTGCAATATTCCATCCACTCATGATGTGATCCGGATTAGTCAGTGTAAATGTACTGCTTCTGACATAAAACGGATGGAAAAAATAATTTCAGAAAAATTGCACTATGAATTGGAAGCTACTACTGCCTTAAACTTTTTGCACTTATACCATACTATTATACTTTGTCATACTTCAGAAAGGAAAGAAATACTGAGCCTTGATAAACTAGAAGCTCAGCTGAAAGCTTGCAACTGCCGACTCATCTTTTCAAAAGCAAAACCATCTGTATTAGCCTTGTGCCTTCTCAATTTGGAAGTGGAAACTTTGAAATCTGTTGAATTACTGGAAATTCTCTTGCTAGTTAAAAAACATTCCAAGATTAATGACACTGAGTTCTTCTACTGTAGAGAGTTGGTTTCTAAATGCCTAGCCGAGTATTCTTCTCCTGAATGTTGCAAACCAGATCTTAAGAAGTTGGTTTGGATCGTTTCAAGGCGCACAGCTCAGAACCTCCACAACAGCTACTATAGTGTTCCTGAGCTGCCAACGATACCTGAAGGGGGTTGTTTGATGAAAGTGAAAGCTTTTGTTGG
Sequenced 3' End CCCACTTTGGAACAAAAAAGTTGGGCAGGGGCCAGAAACTG
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.17|D|10 Available