hGUHO03014

DGRC Stock Number: 1661795

RRID: RRID:DGRC_1661795

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03014

When publishing experiments using hGUHO03014, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03014 (DGRC Stock 1661795 ; https://dgrc.bio.indiana.edu//stock/1661795 ; RRID:DGRC_1661795)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene TMEM120B   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG32795 TMEM120B 13 Yes Yes
Base Vector pGW-HA.attB
AA Size 417
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCACCATGTCCGGGCAGCTGGAGCGTTGCGAGCGCGAATGGCACGAGCTGGAGGGAGAATTTCAAGAACTGCAGGAGACGCACAGGATCTACAAGCAGAAGCTGGAGGAGCTGGCTGCGCTGCAGACGCTGTGTAGCAGTTCCATCAGTAAGCAGAAGAAGCACCTCAAGGACTTGAAGCTTACACTCCAGAGGTGCAAACGCCATGCCAGTCGGGAGGAGGCGGAGCTCGTTCAGCAGATGGCAGCGAACATCAAGGAGCGGCAGGACGTCTTCTTCGACATGGAGGCCTACCTGCCCAAGAAGAACGGGCTCTACTTGAACCTGGTCCTCGGCAATGTGAACGTGACCCTCCTCAGCAACCAGGCCAAGTTCGCCTACAAGGACGAATATGAGAAGTTCAAGCTCTACCTGACCATCATCCTGCTCCTGGGTGCCGTGGCATGTCGATTTGTCCTTCACTACAGGGTGACTGACGAAGTCTTCAACTTCCTGCTGGTGTGGTATTACTGCACCCTGACCATTCGGGAGAGCATTCTCATCAGCAACGGCTCAAGAATTAAAGGCTGGTGGGTGTCTCACCACTACGTCTCCACATTCCTGTCCGGAGTGATGCTGACCTGGCCTAATGGACCCATTTATCAGAAGTTTCGCAACCAGTTCTTAGCATTTTCCATTTTTCAGAGCTGCGTCCAGTTCCTGCAATATTATTACCAGAGGGGCTGCCTCTACCGGCTGCGGGCCCTGGGGGAGAGGAACCACCTGGATCTCACAGTGGAAGGGTTCCAGTCCTGGATGTGGCGGGGCCTCACCTTTCTCCTGCCCTTCCTCTTCTGTGGCCATTTCTGGCAGCTCTACAATGCCGTCACGCTGTTTGAGCTCTCCAGCCACGAGGAATGCAGAGAATGGCAGGTGTTCGTACTGGCGTTCACCTTCCTCATCCTCTTCCTCGGCAACTTCCTGACCACGCTCAAAGTCGTGCATGCCAAGCTCCAGAAGAACAGAGGCAAGACAAAGCAGCCGTTGCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MSGQLERCEREWHELEGEFQELQETHRIYKQKLEELAALQTLCSSSISKQKKHLKDLKLTLQRCKRHASREEAELVQQMAANIKERQDVFFDMEAYLPKKNGLYLNLVLGNVNVTLLSNQAKFAYKDEYEKFKLYLTIILLLGAVACRFVLHYRVTDEVFNFLLVWYYCTLTIRESILISNGSRIKGWWVSHHYVSTFLSGVMLTWPNGPIYQKFRNQFLAFSIFQSCVQFLQYYYQRGCLYRLRALGERNHLDLTVEGFQSWMWRGLTFLLPFLFCGHFWQLYNAVTLFELSSHEECREWQVFVLAFTFLILFLGNFLTTLKVVHAKLQKNRGKTKQPLPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Sequenced 5' End TTGGCACCATGTCCGGGCAGCTGGAGCGTTGCGAGCGCGAATGGCACGAGCTGGAGGGAGAATTTCAAGAACTGCAGGAGACGCACAGGATCTACAAGCAGAAGCTGGAGGAGCTGGCTGCGCTGCAGACGCTGTGTAGCAGTTCCATCAGTAAGCAGAAGAAGCACCTCAAGGACTTGAAGCTTACACTCCAGAGGTGCAAACGCCATGCCAGTCGGGAGGAGGCGGAGCTCGTTCAGCAGATGGCAGCGAACATCAAGGAGCGGCAGGACGTCTTCTTCGACATGGAGGCCTACCTGCCCAAGAAGAACGGGCTCTACTTGAACCTGGTCCTCGGCAATGTGAACGTGACCCTCCTCAGCAACCAGGCCAAGTTCGCCTACAAGGACGAATATGAGAAGTTCAAGCTCTACCTGACCATCATCCTGCTCCTGGGTGCCGTGGCATGTCGATTTGTCCTTCACTACAGGGTGACTGACGAAGTCTTCAACTTCCTGCTGGTGTGGTATTACTGCACCCTGACCATTCGGGAGAGCATTCTCATCAGCAACGGCTCAAGAATTAAAGGCTGGTGGGTGTCTCACCACTACGTCTCCACATTCCTGTCCGGAGTGATGCTGACCTGGCCTAATGGACCCATTTATCAGAAGTTTCGCAACCAGTTCTTAGCATTTTCCATTTTTCAGAGCTGCGTCCAGTTCCTGCAATATTATTACCAGAGGGGCTGCCTCTACCGGCTGCGGGCCCTGGGGGAGAGGAACCACCTGTATCTCACAGTGGAAGGTTCCAGTCCTGATGTGGCGGGGCCTCACCTTTCTCTGCCCTTCTCTTCTGTGGCCATTTCTGGCAGCTCTACATGCCGTCACGCTGTTTGAGCTTCTCCAGCCACGAGGAATGCAGAGAATGGCAGTGTTCGTACTGCGTTCACTTCCTCATCCTCTTCCTCGGCACTCTGACCCCGCTCAAGTCTGCATGCAGCTCCGAAGAACAGAGGCAAGAAAAGCAGCGGTGGCCACTTTCTTTGTACAAGGTGGTGGTACT
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.17|C|11 Available