hGUHO02435

DGRC Stock Number: 1661678

RRID: RRID:DGRC_1661678

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02435

When publishing experiments using hGUHO02435, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02435 (DGRC Stock 1661678 ; https://dgrc.bio.indiana.edu//stock/1661678 ; RRID:DGRC_1661678)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene CAPZA1   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
cpa CAPZA1 14 Yes Yes
Base Vector pGW-HA.attB
AA Size 365
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGCAGGCTCCACCATGGCCGACTTCGATGATCGTGTGTCGGATGAGGAGAAGGTACGCATAGCTGCTAAATTCATCACTCATGCACCCCCAGGGGAATTTAATGAAGTATTCAATGACGTTCGGCTACTACTTAATAATGACAATCTCCTCAGGGAAGGGGCAGCACATGCATTTGCCCAGTATAACATGGATCAGTTCACGCCTGTGAAGATAGAAGGATATGAAGATCAGGTCTTAATTACAGAGCACGGTGACCTGGGTAATAGCAGATTTTTAGATCCAAGAAACAAAATTTCCTTTAAATTTGACCACTTACGGAAAGAAGCAAGTGACCCCCAGCCAGAAGAAGCAGATGGAGGTCTGAAGTCTTGGAGAGAATCCTGTGACAGTGCTTTAAGAGCCTATGTGAAAGACCATTATTCCAACGGCTTCTGTACTGTTTATGCTAAAACTATCGATGGGCAACAGACTATTATTGCATGTATTGAAAGCCACCAGTTTCAGCCTAAAAACTTCTGGAATGGTCGTTGGAGATCAGAGTGGAAGTTCACCATCACACCACCTACAGCCCAGGTGGTTGGCGTGCTTAAGATTCAGGTTCACTATTATGAAGATGGCAATGTTCAGTTGGTTAGTCATAAAGATGTACAGGATTCACTAACTGTTTCGAATGAAGCCCAAACTGCCAAGGAGTTTATTAAAATCATAGAGAATGCAGAAAATGAGTATCAGACAGCAATTAGTGAAAACTATCAAACAATGTCAGATACCACATTCAAGGCCTTGCGCCGGCAGCTTCCAGTTACCCGCACCAAAATCGACTGGAACAAGATACTCAGCTACAAGATTGGCAAAGAAATGCAGAATGCTTTGGACCCAGCTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MADFDDRVSDEEKVRIAAKFITHAPPGEFNEVFNDVRLLLNNDNLLREGAAHAFAQYNMDQFTPVKIEGYEDQVLITEHGDLGNSRFLDPRNKISFKFDHLRKEASDPQPEEADGGLKSWRESCDSALRAYVKDHYSNGFCTVYAKTIDGQQTIIACIESHQFQPKNFWNGRWRSEWKFTITPPTAQVVGVLKIQVHYYEDGNVQLVSHKDVQDSLTVSNEAQTAKEFIKIIENAENEYQTAISENYQTMSDTTFKALRRQLPVTRTKIDWNKILSYKIGKEMQNALDPAFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.16|B|2 Available