hGUHO02060

DGRC Stock Number: 1661561

RRID: RRID:DGRC_1661561

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO02060

When publishing experiments using hGUHO02060, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO02060 (DGRC Stock 1661561 ; https://dgrc.bio.indiana.edu//stock/1661561 ; RRID:DGRC_1661561)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene PPM1M   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG17598 PPM1M 8 No Yes
Base Vector pGW-HA.attB
AA Size 325
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGGCGGCTGCACAGCCCTGGTGGCTGTGTCCCTGCAGGGAAAGCTGTACATGGCCAATGCTGGGGATAGCAGGGCCATCTTGGTGCGGAGAGATGAGATACGGCCACTGAGCTTCGAGTTCACCCCAGAGACTGAGCGGCAGCGGATCCAGCAGCTGGCCTTTGTCTATCCTGAGCTTCTGGCTGGTGAGTTCACCCGACTGGAGTTCCCTCGGCGGCTGAAGGGGGATGACTTGGGACAGAAGGTTTTGTTCAGGGATCACCACATGAGTGGCTGGAGCTACAAACGTGTGGAGAAATCGGATCTCAAGTACCCACTGATCCATGGACAGGGTAGGCAGGCTCGGTTACTAGGAACACTGGCTGTCTCCCGGGGCCTGGGAGACCATCAGCTCAGAGTCCTGGACACAAACATCCAGCTCAAGCCCTTCTTGCTCTCTGTGCCACAGGTGACTGTGCTGGATGTGGACCAGCTGGAGCTACAGGAGGATGATGTGGTTGTCATGGCAACTGATGGACTCTGGGATGTACTGTCCAACGAGCAGGTGGCATGGCTGGTGCGGAGCTTCCTCCCTGGGAACCAAGAGGACCCACACAGGTTCTCAAAGCTGGCCCAGATGCTGATACACAGCACACAGGGAAAGGAAGACAGTCTCACAGAGGAAGGGCAGGTGTCCTACGATGACGTCTCTGTGTTCGTGATTCCCTTGCACAGTCAGGGCCAAGAGAGCAGTGACCACTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MGGCTALVAVSLQGKLYMANAGDSRAILVRRDEIRPLSFEFTPETERQRIQQLAFVYPELLAGEFTRLEFPRRLKGDDLGQKVLFRDHHMSGWSYKRVEKSDLKYPLIHGQGRQARLLGTLAVSRGLGDHQLRVLDTNIQLKPFLLSVPQVTVLDVDQLELQEDDVVVMATDGLWDVLSNEQVAWLVRSFLPGNQEDPHRFSKLAQMLIHSTQGKEDSLTEEGQVSYDDVSVFVIPLHSQGQESSDHCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.14|H|5 Available