hGUHO01423

DGRC Stock Number: 1661319

RRID: RRID:DGRC_1661319

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO01423

When publishing experiments using hGUHO01423, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO01423 (DGRC Stock 1661319 ; https://dgrc.bio.indiana.edu//stock/1661319 ; RRID:DGRC_1661319)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene SPATA6L   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG14079 SPATA6L 9 Yes Yes
Base Vector pGW-HA.attB
AA Size 243
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGCCTCTGGAGGTGGTGGTGGAGCTGCAGATCCGGGCGATTTCTTGCCCAGGAGTGTTCCTGCCTGGCAAACAAGATGTGTACCTCGGGGTCTACCTCATGAATCAGTACCTGGAGACCAACAGCTTTCCCTCTGCGTTCCCCATTATGATTCAGGAGAGCATGAGATTTGAAAAGGTATTTGAAAGTGCAGTAGATCCTGGAGCTGTAGTAGACCTTTTGGAAAGCTTCCTAGCCAGGTTTGAATTAATACAGCTAGTTCCTCCAGTGTGGGATGAGTTGGCCTACTACGAAGAAAACACACGAGATTTTCTTTTCCCAGAGCCCAAGCTGACACCTTCGCACCCTAGGAGGTGTAGGGAGGTGCTCATGAAGACGGCTCTGGGTTTTCCAGGCATTGCTCCCAAAATAGAGTTTTCTACAAGGACAGCCATCAGAGAATGTGTGTTTCTGCATAGAAACAGATTTCTTGTTGATTCCAAATCTTGGCTATTGTGCCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MPLEVVVELQIRAISCPGVFLPGKQDVYLGVYLMNQYLETNSFPSAFPIMIQESMRFEKVFESAVDPGAVVDLLESFLARFELIQLVPPVWDELAYYEENTRDFLFPEPKLTPSHPRRCREVLMKTALGFPGIAPKIEFSTRTAIRECVFLHRNRFLVDSKSWLLCPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.12|D|3 Available