hGUHO03405

DGRC Stock Number: 1661295

RRID: RRID:DGRC_1661295

Donor: BDGP

Ships via United States Priority Mail

This clone has been verified by BDGP. The ORF, including the tag, has been fully sequenced and the sequence is available below.



No Image Available


Price: $46.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite hGUHO03405

When publishing experiments using hGUHO03405, please include the following details in your manuscript.

  • Materials and Methods
    hGUHO03405 (DGRC Stock 1661295 ; https://dgrc.bio.indiana.edu//stock/1661295 ; RRID:DGRC_1661295)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Homo sapiens
Collections Human ORF
Human Gene COG4   ( Entrez , HGNC )
Orthology
FlyHumanDIOPT ScoreDIOPT RankBest HitBest Reverse Hit
CG7456 COG4 14 Yes Yes
Base Vector pGW-HA.attB
AA Size 611
Tag Info 3xHA
Verified Nucleotide Sequence CAAGTTTGTACAAAAAAGTTGGCATGGTGCTGGGGACAGACATGAGTGATCGGAGAGCTGCAGTCATCTTTGCAGATACACTTACTCTTCTGTTTGAAGGGATTGCCCGCATTGTGGAGACCCACCAGCCAATAGTGGAGACCTATTATGGGCCAGGGAGACTCTATACCCTGATCAAATATCTGCAGGTGGAATGTGACAGACAGGTGGAGAAGGTGGTAGACAAGTTCATCAAGCAAAGGGACTACCACCAGCAGTTCCGGCATGTTCAGAACAACCTGATGAGAAATTCTACAACAGAAAAAATCGAACCAAGAGAACTGGACCCCATCCTGACTGAGGTCACCCTGATGAATGCCCGCAGTGAGCTATACTTACGCTTCCTCAAGAAGAGGATTAGCTCTGATTTTGAGGTGGGAGACTCCATGGCCTCAGAGGAAGTAAAGCAAGAGCACCAGAAGTGTCTGGACAAACTCCTCAATAACTGCCTTTTGAGCTGTACCATGCAGGAGCTAATTGGCTTATATGTTACCATGGAGGAGTACTTCATGAGGGAGACTGTCAATAAGGCTGTGGCTCTGGACACCTATGAGAAGGGCCAGCTGACATCCAGCATGGTGGATGATGTCTTCTACATTGTTAAGAAGTGCATTGGGCGGGCTCTGTCCAGCTCCAGCATTGACTGTCTCTGTGCCATGATCAACCTCGCCACCACAGAGCTGGAGTCTGACTTCAGGGATGTTCTGTGTAATAAGCTGCGGATGGGCTTTCCTGCCACCACCTTCCAGGACATCCAGCGCGGGGTGACAAGTGCCGTGAACATCATGCACAGCAGCCTCCAGCAAGGCAAATTTGACACAAAAGGCATCGAGAGTACTGACGAGGCGAAGATGTCCTTCCTGGTGACTCTGAACAACGTGGAAGTCTGCAGTGAAAACATCTCCACTCTGAAGAAGACACTGGAGAGTGACTGCACCAAGCTCTTCAGCCAGGGCATTGGAGGGGAGCAGGCCCAGGCCAAGTTTGACAGCTGCCTTTCTGACTTGGCCGCCGTGTCCAACAAATTCCGAGACCTCTTGCAGGAAGGGCTGACGGAGCTCAACAGCACAGCCATCAAGCCACAGGTGCAGCCTTGGATCAACAGCTTTTTCTCCGTCTCCCACAACATCGAGGAGGAAGAATTCAATGACTATGAGTCCAACGACCCTTGGGTACAACAGTTCATCCTTAACCTGGAGCAGCAAATGGCAGAGTTCAAGGCCAGCCTGTCCCCGGTCATCTACGACAGCCTAACCGGCCTCATGACTAGCCTTGTTGCCGTCGAGTTGGAGAAAGTGGTGCTGAAATCCACCTTTAACCGGCTGGGTGGTCTGCAGTTTGACAAGGAGCTGAGGTCACTCATTGCCTACCTTACCACGGTGACCACCTGGACCATCCGAGACAAGTTTGCCCGGCTCTCCCAGATGGCCACCATCCTCAATCTGGAGCGGGTGACCGAGATCCTCGATTACTGGGGACCCAATTCCGGCCCATTGACGTGGCGCCTCACCCCTGCTGAAGTGCGCCAGGTGCTGGCCCTGCGGATAGACTTCCGCAGTGAAGATATCAAGAGGCTGCGCCTGTACCCAACTTTCTTGTACAAAGTGGTGGTACCTCGAAGTTCCTATTCTCTACTTAGTATAGGAACTTCCATCCTTGGAGCTCCTTCAGGAGGCGGTGCTACTGCTGGCGCTGGTGGAGCCGGTGGACCTGCGGGGTTAATTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTTGA
AA Sequence MVLGTDMSDRRAAVIFADTLTLLFEGIARIVETHQPIVETYYGPGRLYTLIKYLQVECDRQVEKVVDKFIKQRDYHQQFRHVQNNLMRNSTTEKIEPRELDPILTEVTLMNARSELYLRFLKKRISSDFEVGDSMASEEVKQEHQKCLDKLLNNCLLSCTMQELIGLYVTMEEYFMRETVNKAVALDTYEKGQLTSSMVDDVFYIVKKCIGRALSSSSIDCLCAMINLATTELESDFRDVLCNKLRMGFPATTFQDIQRGVTSAVNIMHSSLQQGKFDTKGIESTDEAKMSFLVTLNNVEVCSENISTLKKTLESDCTKLFSQGIGGEQAQAKFDSCLSDLAAVSNKFRDLLQEGLTELNSTAIKPQVQPWINSFFSVSHNIEEEEFNDYESNDPWVQQFILNLEQQMAEFKASLSPVIYDSLTGLMTSLVAVELEKVVLKSTFNRLGGLQFDKELRSLIAYLTTVTTWTIRDKFARLSQMATILNLERVTEILDYWGPNSGPLTWRLTPAEVRQVLALRIDFRSEDIKRLRLYPTFLYKVVVPRSSYSLLSIGTSILGAPSGGGATAGAGGAGGPAGLIYPYDVPDYAGYPYDVPDYAGSYPYDVPDYA*
Collection Well Status Note
Human ORF HumanORF hGUHO-RA.12|B|3 Available