TfBAC00347
|
DGRC Stock Number: 1660860 RRID: RRID:DGRC_1660860 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00347
When publishing experiments using TfBAC00347, please include the following details in your manuscript.
- Materials and Methods
TfBAC00347 (DGRC Stock 1660860 ; https://dgrc.bio.indiana.edu//stock/1660860 ; RRID:DGRC_1660860)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | akirin (FBgn0082598) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | akirin |
| BAC | CH322-140K23 |
| Tag | AV001 |
| 50bp Preceding Tag | GGTCATGGTTATAGTGCTAATTACATTATATTTTTATTTCAGACCTGTCG |
| Tagged Transcripts |
FBtr0076848 FBtr0076849 FBtr0302543 FBtr0302544 FBtr0302545 FBtr0332730 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC3|D|11 | Available |
