TfBAC00251
DGRC Stock Number: 1660768 RRID: RRID:DGRC_1660768 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00251
When publishing experiments using TfBAC00251, please include the following details in your manuscript.
- Materials and Methods
TfBAC00251 (DGRC Stock 1660768 ; https://dgrc.bio.indiana.edu//stock/1660768 ; RRID:DGRC_1660768)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | dl (FBgn0260632) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | dl-Large AV7 |
BAC | CH321-10D24 |
Tag | AV007 |
50bp Preceding Tag | TGCGCCTCAATTCGGAAGATCTGCAGATATCGAACCTGTCCATATCCACG |
Tagged Transcripts |
FBtr0301383 FBtr0301384 FBtr0006005 FBtr0006050 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC2|E|3 | Available |