TfBAC00245
DGRC Stock Number: 1660762 RRID: RRID:DGRC_1660762 |
No Image Available
Price: $84.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00245
When publishing experiments using TfBAC00245, please include the following details in your manuscript.
- Materials and Methods
TfBAC00245 (DGRC Stock 1660762 ; https://dgrc.bio.indiana.edu//stock/1660762 ; RRID:DGRC_1660762)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | Sox102F (FBgn0039938) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | Sox102F AV7 |
BAC | CH321-13J1 |
Tag | AV007 |
50bp Preceding Tag | GTTTTTCTTCCGATGAAGTGGAACTTGCATCTCAGCGCGAGCTAGACGAC |
Tagged Transcripts |
FBtr0089252 FBtr0100600 FBtr0334488 FBtr0334489 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC2|D|9 | Available |